Brucella melitensis
I. Organism Information
A. Taxonomy Information
-
Species:
-
Brucella melitensis (Morenoa et al., 2002):
-
GenBank Taxonomy No.:
29459
-
Description: According to the new taxonomy used by NCBI, the classic Brucella spp. are named Brucella melitensis, which include Brucella melitensis 16M and 5 biovars: Abortus, Canis, Neotomae, Ovis, and Suis. However, the traditional taxonomy is still widely used, where Brucella spp. include B. melitensis, B. abortus, B. suis, B. canis, B. neotomae, and B. ovis. This document is focused on the first three species.
-
Variant(s):
-
Brucella melitensis biovar 1 strain 16M (Morenoa et al., 2002, Gandara et al., 2001):
-
GenBank Taxonomy No.:
224914
-
Parent:
Brucella melitensis
-
Description: Strain 16M, corresponding to ATCC 23456, is the type strain for this biovar. Strain 16M primarily affects goats and sheep, and is the most virulent of the Brucellae in humans.
-
Brucella melitensis biovar Abortus (Morenoa et al., 2002):
-
GenBank Taxonomy No.:
235
-
Parent:
Brucella melitensis
-
Description: Brucella abortus primarily affects cattle, and is the most common of the Brucellae that infect humans.
-
Brucella melitensis biovar Suis (Morenoa et al., 2002):
-
GenBank Taxonomy No.:
29461
-
Parent:
Brucella melitensis
-
Description: Brucella suis primarily affects swine, and is intermediate between B. melitensis and B. abortus in virulence in humans.
-
Brucella melitensis biovar 1 (Gandara et al., 2001):
-
Parent:
Brucella melitensis
-
Description: Brucella melitensis biovar 1 strain 16M, corresponding to ATCC 23456, is the type strain for this biovar. Strain REV-1 is the rough attenuated vaccine strain of this biovar. Brucella melitensis biovar 1 isolates 78, 87, 91, 113, 219, 256, 261, 376, 391, 392, 393, 400, 401, 402, 415, 450, 456, 457, 458, 461, 462, 485, LAR, and P217 were obtained from human blood and bone marrow samples. Brucella melitensis isolates 279, 280, and 371 were obtained from goat milk samples.
-
Brucella melitensis biovar 2 (Gandara et al., 2001):
-
Parent:
Brucella melitensis
-
Description: Strain 63/9, corresponding to ATCC 23457, is the type strain for this biovar. Brucella melitensis isolate 84 was obtained from human blood and bone marrow samples.
-
Brucela melitensis biovar 3 (Gandara et al., 2001):
-
Parent:
Brucella melitensis
-
Description: Ether strain, corresponding to ATCC 23458, is the type strain for this biovar. Brucella melitensis biovar 3 isolates 254, 255, 257, 258, 259 and 306 were obtained from human blood and bone marrow samples. Brucella isolates G914, G1024 and T64/40 also belong to B. melitensis biovar 3.
-
Brucella abortus biovar 1 (Gandara et al., 2001):
-
Parent:
Brucella melitensis biovar Abortus
-
Description: Strain 544, corresponding with ATCC 23448, is the type strain for this biovar. Strain S19 is a smooth attenuated vaccine strain of this biovar. Strain RB51 is a rough attenuated vaccine strain of this biovar. Strain ENCB was obtained from human blood and bone marrow samples. Brucella abortus biovar 1 isolates 223, 240, 264, 265, 266, 267, 268, 269, 270, 271, 272, 275, 307, 308, 309, 311, 312, 313, and 314 were obtained from cow milk and cheese samples.
-
Brucella abortus biovar 5 (Gandara et al., 2001):
-
Parent:
Brucella melitensis biovar Abortus
-
Description: Brucella abortus biovar 5 strain B3196, corresponding to ATCC 23452, is the type strain for this biovar. Isolates 273 and 274 were obtained from cow milk and cheese samples. Strain 49/8 also belongs to Brucella abortus biovar 5.
-
Brucella suis biovar 1 (Gandara et al., 2001):
-
Parent:
Brucella melitensis biovar Suis
-
Description: B. suis strain 1330, corresponding to ATCC 23444, is the type strain for B. suis. B. suis strain S2CH is the vaccine strain of this biovar. B. suis biovar 1 strains 106 and 387 were obtained from human blood and bone marrow samples. B suis biovar 1 strains 129, 191, 192, and 377 were obtained from cow milk and cheese samples.
B. Lifecycle Information
(Ministry of Agriculture and Fisheries, 1977):
-
Vegetative cell
(Ministry of Agriculture and Fisheries, 1977):
-
Size: Brucella species range in size from 0.6 - 1.5 microns by 0.5 - 0.7 microns.
-
Shape: Brucella species are classified as gram-negative coccobacilli.
-
Picture(s):
-
B. abortus SEM Image (Website 16):
Description: Scanning Electron Micrograph of Brucella abortus - Gram-negative, coccobacillus prokaryote; causes bovine spontaneous abortion due to i
ts rapid growth in the presence of erythritol (produced in the placenta).This is an example of tissue specificity. This zoonotic microorganism can pass from cattle to humans in contaminated dairy products. Magnification: x3,900.
-
B. melitensis SEM Image (Website 16):
Description: Scanning Electron Micrograph of Brucella melitensis - Gram-negative, aerobic, coccobacillus prokaryote; causes brucellosis fever (also known as undulant or Malta fever). This zoonotic microorganism passes from goats and sheep to humans in contaminated dairy products. Magnification: x3,600.
C. Genome Summary:
-
Genome of Brucella melitensis biovar 1 strain 16M
(Website 12, Website 13):
-
Description:
Brucella melitensis contains two circular chromosomes, and is not known to contain any naturally occurring plasmids (Website 12, Website 13).
-
chromosome (Website 12):
-
GenBank Accession Number:
AE008917
-
Size: Brucella melitensis chromosome I is 2117144 base pairs long.
-
Gene Count: Brucella melitensis chromosome I contains 2059 protein encoding genes.
-
Description: Chromosome I is circular.
-
chromosome (Website 13):
-
GenBank Accession Number:
AE008918
-
Size: Brucella melitensis chromosome II is 1177787 base pairs long.
-
Gene Count: Brucella melitensis chromosome II contains 1139 protein encoding genes.
-
Description: Chromosome II is circular.
-
Genome of Brucella suis biovar 1 strain 1330
(Paulsen, 2002):
-
Description: Brucella suis contains two circular chromosomes, and is not known to contain any naturally occurring plasmids.
-
chromosome (Website 12):
-
GenBank Accession Number:
NC_004310
-
Size: Brucella suis 1330 chromosome I is 2107792 base pairs long.
-
Gene Count: Brucella suis 1330 chromosome I contains 2185 protein encoding genes.
-
Description: Chromosome I is circular.
-
chromosome (Website 13):
-
GenBank Accession Number:
NC_004311
-
Size: Brucella suis 1330 chromosome II is 1207381 base pairs long.
-
Gene Count: Brucella suis 1330 chromosome II contains 1203 protein encoding genes.
-
Description: Chromosome II is circular.
II. Epidemiology Information
A. Outbreak Locations:
-
Brucellosis is pandemic (except UK and Australia); prevalence is higher in countries not requiring pasteurization of dairy products, especially Mediterranean Europe, the Middle East, and parts of South America (Boschiroli et al., 2001) .
B. Transmission Information:
-
From:
Bos taurus To:
Bos taurus (Boschiroli et al., 2001):
Mechanism: Brucella abortus may be transmitted vertically (transmammary or transplacental), venereally, orally, through the conjunctiva, or by inhalation of aerosolized organisms.
-
From:
Bos taurus To:
Homo sapiens (Boschiroli et al., 2001):
Mechanism: Brucella abortus, Brucella suis, or Brucella melitensis may be transmitted by ingestion of unpasteurized dairy products, direct contact of infected tissues to mucous membranes or wounds, inhalation of aerosolized organisms.
-
From:
Goats and Sheep To:
Goats and Sheep (Boschiroli et al., 2001):
Mechanism: Brucella melitensis may be transmitted vertically (transmammary or transplacental), venereally, orally, through the conjunctiva, or by inhalation of aerosolized organisms.
-
From:
Goats and Sheep To:
Homo sapiens (Boschiroli et al., 2001):
Mechanism: Brucella melitensis may be transmitted by ingestion of unpasteurized dairy products, direct contact of infected tissues to mucous membranes or wounds, inhalation of aerosolized organisms.
-
From:
Goats and Sheep To:
Bos taurus (Boschiroli et al., 2001):
Mechanism: Brucella melitensis may be transmitted from sheep or goats to cattle by feedstuff contaminated with infected feces, urine, or uterine or placental fluids as well as by intraspecies transmission mechanisms.
-
From:
Wild animals To:
Homo sapiens (Boschiroli et al., 2001):
Mechanism: Brucella species may be transmitted in laboratory situations by direct contact of agent to mucous membranes or wounds, inhalation of aerosol organisms, accidental inoculation with infective vaccine strains, or misidentification and subsequent negligence of safety procedures.
C. Environmental Reservoir:
-
Wild animals
(Bercovich, 2000, Website 15):
-
Description: Wild mammals such as elk, bison, and wild boar serve as reservoirs for Brucella organisms.
-
Survival Information:
Brucella organisms can survive in tap water for several months. Brucella can survive in feces, slurry, or liquid manure 30-210 days. They can survive freezing temperatures and high environmental temperatures. Dessication greatly reduces survival of brucellae (Bercovich, 2000, Nicoletti, 1980, Alton et al., 1988).
-
Wild animals
(Bercovich, 2000, Website 15):
-
Description: Laboratoty environment includes bacterial cultures and contaminations.
D. Intentional Releases:
-
Intentional Release information
(Website 3):
-
Description:
Brucella organisms could be released in aerosol form, by accidental spills of culture suspensions or live vaccines, or in liquids such as dairy products or water. Brucellosis has fairly low fatality rate, but could be used as an incapacitating agent, as the disease tends to be chronic, requiring prolonged treatment (Website 3).
-
Emergency contact:
Local health departments and local law enforcement agencies should be contacted in the event of accidental or intentional release of Brucella species (Website 3).
-
Delivery mechanism: Brucella organisms could be aerosolized and released at infectious doses. 10-500 organisms in aerosol form constitute an infectious dose.
-
Containment: Most commercial disinfectants are effective at killing or neutralizing Brucella organisms.
III. Infected Hosts
-
Human:
-
Taxonomy Information:
-
Species:
-
Human:
-
GenBank Taxonomy No.:
9606
-
Scientific Name: Homo sapiens
-
Description: Humans may carry the disease, but transmission from human to human is very rare.
-
Infection Process:
-
Infectious Dose: 10-500 organisms in aerosol form constitute an infectious dose.
-
Description:
Brucella organisms enter both professional and nonprofessional phagocytes by phagocytosis, where they replicate inside vacuoles (Young, 1995).
-
Disease Information:
-
Undulant fever, Malta fever
(i.e., Brucellosis)
(Website 9):
-
Pathogenesis Mechanism:
The main virulence factor of Brucella is the ability to live and replicate inside cells of the reticuloendothelial system. Cell wall lipopolysaccharide and superoxide dismutase appear to contribute greatly to the reaction of the host immune system. TNF alpha and IL1 are both suppressed in Brucella infected patients (Baldwin et al., 1994, Boschiroli et al., 2001).
There are a few steps regarding the pathogenesis of Brucella suis: 1. Brucella encounter host macrophages, no evidence of oxidative burst can be detected. 2. Brucella uptake by lipid rafts. Cholesterol-rich domains (such as cholesterol and ganglioside GM1, two components of lipid rafts) are necessary for Brucella penetration. 3. Inside the cell, a proton pump (probably of cellular origin) rapidly acidifies the phagosome resulting in a stress for the bacteria and also in a signal that triggers virulence genes activation. Also nutrient depletion happens in the phagosome environment. 4. Lipid rafts on the phagosome are involved in the isolation of the phagosome from classical cellular traffic. 5. Lysosomes do not fuse with the Brucella phagosome, and the normal trafficking of the cell is not affected during infection. The inhibition of phagosome-lysosome fusion is a mechanism to limit deleterious effects of macrophage attack. 6. Inside the phagosomes, the activation of bacterial genes is correlated with oxygen limitation. 7. Intracellular brucellae have to synthesize their amino acids to multiply, implying that the bacteria are starved in this environment. The intracellular survival and multiplication of pathogens like brucellae may require the induction of chaperones such as DnaK for the correct synthesis and activation of certain virulence factors (Kohler et al., 2002).
-
Incubation Period: Incubation ranges from 3-60 days. Respiratory acquired infection exhibits shorter incubation periods than cutaneously acquired infection.
-
Symptom Information
:
-
Febrile illness (Website 9, Website 11):
-
Description: Brucellosis is usually characterized by nonspecific febrile illness, including irregular and intermittent fever and chills and is observed in 90% of brucellosis cases.
-
Observed: Febrile illness is observed in 90% of brucellosis cases.
-
Systemic symptoms (Website 9, Website 11):
-
Description: Brucellosis commonly causes systemic symptoms such as arthralgia, myalgia, depression, and weight loss.
-
Cardiac symptoms (Website 9, Website 11):
-
Description: Brucellosis may cause cardiac symptoms, primarily bacterial endocarditis, which accounts for 80% of Brucellosis mortality.
-
Cough and pleuritic chest pain (Website 9, Website 11):
-
Description: Brucellosis patients may exhibit cough and pleuritic chest pain not denoting pneumonia.
-
Observed: Respiratory symptoms are observed in 20% of brucellosis cases.
-
Osteoarticular symptoms (Website 9, Website 11):
-
Description: Brucellosis patients often exhibit osteoarticular symptoms including sacroilitis, vertebral osteomyelitis, and other large joint infections.
-
Observed: Osteoarticular symptoms are observed in 20-60% of brucellosis cases.
-
Central nervous system symptoms (Website 9, Website 11):
-
Description: Brucellosis may be exhibited in central nervous system symptoms, including chronic meningioencephalitis, and occasionally subarachnoid hemorrhage and myelitis.
-
Genitourinary symptoms (Website 9, Website 11):
-
Description: Brucellosis may be exhibited in genitourinary symptoms, most commonly orchitis and epididymitis, but including pyelonephritis and cystitis.
-
Observed: Genitourinary symptoms are observed in 2-20% of brucellosis cases.
-
Gastrointestinal symptoms (Young, 1995):
-
Description: Brucellosis often causes gastrointestinal symptoms, including anorexia, weight loss, nausea, vomiting, and abdominal discomfort.
-
Observed: A majority of patients with brucellosis who are infected by contaminated food, water, or milk are reported to suffer from gastrointestinal symptoms.
-
Treatment Information:
-
Antibiotic therapy (Website 9, Corbel, 1997): Doxycycline (200 mg/d) orally and rifampin (600-900 mg/d) for 6 weeks is a commonly recommended treatment of human brucellosis.
-
Applicable: Most cases of adult systemic brucellosis may be treated with this regimen.
-
Contraindicator: Contraindications include people with antibiotic allergies and pregnant women.
-
Complication: Relapses occur in 5% of patients due to sequestered organisms.
-
Success Rate: This treatment shows a 95% first treatment success rate.
-
Antibiotic therapy (Website 9, Corbel, 1997): Intramuscular streptomycin (1g/d) for 2 weeks and oral rifampin (600-900 mg/d) for 6 weeks is a commonly recommended regimen.
-
Applicable: This treatment is applicable for most cases of adult brucellosis.
-
Contraindicator: Contraindications are people with antibiotic allergies and pregnant women.
-
Complication: Relapses occur in 5% of patients due to sequestered organisms.
-
Success Rate: This treatment shows a 95% success rate for first treatment.
-
Antibiotic therapy (Website 11, Corbel, 1997): Trimethoprim-sulfamethoxazole orally (80/400 and 320/1600 mg/d) and rifampin (600-900 mg/d) for 6 weeks is a commonly recommended regimen for these applications.
-
Applicable: This treatment is applicable in CNS disease and for children under 8 years.
-
Contraindicator: People with antibiotic allergies are contraindicated for this treatment.
-
Complication: Relapses occur in 30% of first time treatments, and CNS treatment may require prolonged therapy.
-
Success Rate: Success rate for this treatment is 70% first treatment.
-
Antibiotic therapy plus surgical replacement of valves (Website 11, Corbel, 1997): Rifampin, streptomycin, and doxycyline for 6 weeks is a commonly recommended regimen for this application.
-
Applicable: This treatment is applicable for Brucella endocarditis.
-
Contraindicator: People with antibiotic allergies are contraindicated for this treatment.
-
Complication: Infected valves should be replaced early in treatment.
-
Antibiotic therapy (Website 11): Rifampin is a commonly recommended drug for treatment of pregnant women.
-
Applicable: This treatment is applicable for pregnant women.
-
Antibiotic therapy (Shamelian, 2000): Doxycyclin 100 mg once or twice daily for 6 weeks combined with streptomcycin 1 g/day for 2 weeks.
-
Applicable: Most adult infected with brucellosis.
-
Contraindicator: Contraindications include people with antibiotic allergies.
-
Prevention:
-
Eradication (Young, 1995):
-
Description: Eradication of domestic animals infected with brucellosis
-
Efficacy:
-
Rate: 100% eradication leads to dramatic decreased chance of transmission of brucellosis to humans.
-
Duration: Duration of efficacy equals duration of effective eradication.
-
Contraindicator: No contraindicators known.
-
Complication: False positives and negatives complicate diagnosis of domestic animals and wild animal reservoirs may not be available for testing. Importation of infected animals would renew population prevalence.
-
Pasteurization (Young, 1995):
-
Description: Pasteurization of milk and dairy products.
-
Efficacy:
-
Duration: for the shelf life of the product
-
Contraindicator: No contraindications known.
-
Complication: Prevention is limited as to mechanism of infection and only applies to infection by ingestion of contaminated dairy products.
-
Vaccination (Schurig et al., 2002):
-
Description: Current live vaccine strain B. abortus strain RB51 is effective in prevention of brucellosis in animals. However, this live vaccine strain is still sufficiently pathogenic to humans and causes disease and is cantraindicated for human use.
-
Contraindicator: Live organism vaccines tested on humans have caused disease, no vaccine currently used is attenuated sufficiently for human use.
-
Complication: A vaccine effective and safe for human use has yet to be developed.
-
Model System:
-
Mouse model (Baldwin et al., 1994, Buhrman, 1989):
-
Model Host: Mice can be infected with Brucella, but are not natural hosts to the bacteria, and do not display identical symptoms to humans. Bacteria tend to localize in the mouse spleen, and in immunocompetent mice are cleared from the body by the immune system. Mouse macrophage cell lines (e.g., J774) are also often used for Brucella research.
-
Model Pathogens:
-
Cow:
-
Taxonomy Information:
-
Species:
-
Cow:
-
GenBank Taxonomy No.:
9913
-
Scientific Name: Bos taurus
-
Description: Cattle are mainly infected by B. abortus.
-
Infection Process:
-
Description:
Brucella organisms enter both professional and nonprofessional phagocytes by phagocytosis, where they replicate inside vacuoles (Young, 1995).
-
Disease Information:
-
Bang's Disease or Abortive Fever
(i.e., Bovine Brucellosis)
(Bercovich, 1998):
-
Pathogenesis Mechanism:
The virulence of Brucella in cattle is mainly due to their ability to replicate intracellularly. They preferentially utilize erythritol, and frequently inhabit the mature reproductive tract which is high in this sugar (Nicoletti, 1980).
-
Incubation Period:
Incubation periods of bovine brucellosis range between 53 to 251 days (Nicoletti, 1980).
-
Symptom Information
:
-
Reproductive symptoms (Buhrman, 1989, Garcia-Carrillo, 1990):
-
Description: Reproductive symptoms are most commonly seen in cattle and include abortion, lowered fertility in the cow, orchitis in the bull and lowered milk production.
-
Observed: An approximately 24% rate in loss of milk production is reported in infected cows in the US.
-
Osteoarticular symptoms (Buhrman, 1989):
-
Description: Brucella melitensis sometimes causes osteoarticular symptoms in cattle as well as reproductive symptoms. Infection of large joint capsules may be seen in cattle infected with B. melitensis.
-
Treatment Information:
-
antibiotics (Radwan et al., 1993): Three therapeutic regimens were evaluated in 121 cows naturally infected with Brucella melitensis or Brucella abortus, using a combination of long-acting oxytetracycline (LA-OTC), streptomycin (ST) and OTC-intramammary infusion (IMI). Cessation of shedding of Brucella in udder secretions and absence of Brucella in selected tissues were considered criteria for successful treatment. Regimen A (tested on 35 cows) consisted of LA-OTC 25 mg/kg administered intramuscularly (i.m.) every 3 days for 42 days, ST 25 mg/kg i.m. daily for 8 days, and OTC-IMI 20 ml/teat daily for 4 days. Regimen B (tested on 53 cows) was similar to regimen A, except that ST was administered every 2 days for 16 days and OTC-IMI every 2 days for 8 days. Both regimens were equally effective in eliminating Brucella organisms from all cows involved in the tests and no relapses were recorded. However, regimen C, which was similar to regimen A, except that ST was administered every 3 days for 24 days and OTC-IMI every 3 days for 12 days, resulted in the elimination of Brucella organisms from only 30 (91%) of 33 cows. Before commencement of the therapeutic regimens, B. melitensis biovar 1 or 2 had been repeatedly isolated from udder secretions of 103 cows and B. abortus biovar 1 from mammary secretions of 18 cows
-
Prevention:
-
Eradication (Bercovich, 1998):
-
Description: Eradication of Brucella infected cow
-
Efficacy:
-
Rate: 100% eradication leads to 100% efficacy rate.
-
Duration: Duration of efficacy equals duration of effective eradication.
-
Contraindicator: No contraindications known.
-
Complication: False positives and negatives complicate diagnosis of domestic animals and wild animal reservoirs may not be available for testing. Importation of infected animals would renew population prevalence.
-
S19 vaccine (Lord et al., 1998, Buhrman, 1989, Schurig et al., 2002):
-
Description: Live attenuated B. abortus vaccine strain 19 (S19)
-
Efficacy:
-
Rate: Efficacy rate of this vaccine is reported to be 65-75%
-
Duration: The S19 vaccine is protective against abortion for five pregnancies, and often for the life of the cow.
-
Contraindicator:
Contraindications of strain S19 include pregnant cattle, in which the vaccine may cause abortions, and humans, as the vaccine is virulent to humans (Lord et al., 1998).
This strain induces reasonable protection against B. abortus, but at the expense of persistent serological responses (Schurig et al., 2002).
-
Complication: Cattle vaccinated with S19 may appear as false positives on diagnostic tests for brucellosis based on LPS antigen or antibodies.
-
RB51 vaccine (Lord et al., 1998, Buhrman, 1989, Uzal et al., 2000, Edmonds et al., 1999, Schurig et al., 2002):
-
Description: B. abortus vaccine strain RB51 is a rough live attenuated vaccine. It is administered parenterally. This vaccine does not cause later diagnostic false positives.
-
Efficacy:
-
Rate: Efficacy rate of this vaccine is reported to be near 100% when heifers are vaccinated at 3 months, and 87% when vaccinated at 5 months.
-
Contraindicator: Strain RB51 does not cause abortions in pregnant cattle, or appear to cause reproductive problems in mature bulls.
-
Model System:
-
Mouse model (Baldwin et al., 1994, Buhrman, 1989):
-
Model Host: Mice can be infected with Brucella, but are not natural hosts to the bacteria, and do not display identical symptoms to cattle. Bacteria tend to localize in the mouse spleen, and in immunocompetent mice are cleared from the body by the immune system. Mouse macrophage cell lines (e.g., J774) are also often used for Brucella research.
-
Model Pathogens:
-
Goats and Sheep:
-
Taxonomy Information:
-
Species:
-
Goats:
-
GenBank Taxonomy No.:
9925
-
Scientific Name: Capra hircus
-
Description: Sheep and goats can carry B. melitensis.
-
Sheep:
-
GenBank Taxonomy No.:
9940
-
Scientific Name: Ovis aries
-
Description: Sheep and goats can carry B. melitensis.
-
Infection Process:
-
Description:
Brucella organisms enter both professional and nonprofessional phagocytes by phagocytosis, where they replicate inside vacuoles (Young, 1995).
-
Disease Information:
-
Bang's Disease
(i.e., Brucellosis)
:
-
Pathogenesis Mechanism:
The virulence of Brucella in goats is mainly due to the ability to replicate intracellularly (Boschiroli et al., 2001).
-
Symptom Information
:
-
Reproductive symptoms (Bercovich, 1998):
-
Description: Reproductive symptoms are the most common shown in Brucella melitensis infected sheep and goats, and include abortion, reduced fertility and milk production in the female and orchitis in the male.
-
Chronic bronchitis (Bercovich, 1998):
-
Description: Chronic bronchitis is sometimes observed in sheep and goats infected with B. melitensis.
-
Osteoarticular symptoms (Bercovich, 1998):
-
Description: Colonization of the joint capsules by B. melitensis may lead to osteoarticular symptoms and arthritis.
-
Prevention:
-
eradication (Blasco et al., 1997):
-
Description: Eradication of Brucella infected sheep and goats.
-
Efficacy:
-
Rate: 100% eradication leads to 100% efficacy rate.
-
Duration: Duration of efficacy equals duration of effective eradication.
-
Contraindicator: No contraindications known.
-
Complication: False positives and negatives complicate diagnosis of domestic animals and wild animal reservoirs may not be able to be tested. Importation of infected animals would renew population prevalence.
-
REV-1 vaccine (Blasco et al., 1997, Schurig et al., 2002):
-
Description:
Live attenuated vaccine B. melitensis strain REV 1 is administered conjunctivally to small ruminants (Blasco et al., 1997).
-
Efficacy:
-
Rate: Rate of efficacy for this vaccine is highly variable due to dosage differences and quality of the manufactured vaccine worldwide.
-
Duration: Currently it is hypothesized that duration of protection for this vaccine is lifelong, but this assumption remains to be proven.
-
Contraindicator: REV1 may cause disease in humans if accidentally inoculated. Vaccination of pregnant animals results in abortion.
-
Complication: Persistent infections may cause infectious organisms to be shed in milk intended for human consumption.
-
Model System:
-
Mouse model (Baldwin et al., 1994, Buhrman, 1989):
-
Model Host: Mice can be infected with Brucella, but are not natural hosts to the bacteria, and do not display identical symptoms to sheep and goats. Bacteria tend to localize in the mouse spleen, and in immunocompetent mice are cleared from the body by the immune system. Mouse macrophage cell lines (e.g., J774) are also often used for Brucella research.
-
Model Pathogens:
IV. Labwork Information
A. Biosafety Information:
-
General biosafety information
(Website 2):
-
Biosafety Level: Biosafety level three (3) procedures should be followed in all laboratory culture of all virulent Brucellae.
-
Precautions:
- Brucellosis is the most commonly reported laboratory acquired infection. Brucella organisms may be misidentified. Brucella organisms can become airborne during standard laboratory procedures.
-
Disposal:
- Upon termination of use of the agent, all cultures and stocks of it will be a) securely stored in accordance with prudent laboratory practices b) transferred to another registered facility in accordance with CDC regulations, or c) destroyed on site by autoclaving, incineration, or another recognized sterilization or neutralization process. When an agent, previously transferred to a facility in accordance with government regulations, is consumed or destroyed, the responsible facility official must formally notify the registering entity. Formal notification must be noted on CDC Form EA-101 and a copy kept on record by the responsible facility official for a period of five (5) years.
B. Culturing Information:
-
General Culturing Information
(Alton et al., 1988):
-
Description: From humans the organism is most commonly isolated from blood or bone marrow, but may be isolated from the liver, the spleen, cerebrospinal fluid or focal abscess. From sheep, goats, and cattle, the organism is most commonly cultured from the reproductive tract or reproductive fluids, including semen, uterine fluids and tissues, and milk.
-
Medium:
- Standard blood media may be used for blood or bone marrow specimens, other specimens may use Trypticase soy agar with 5% sheep blood agar, MacConkey agar, or Martin Lewis agar (BD Bioscience or Remel, Inc., or equivalent)
-
Optimal Temperature: 35-37 degrees Celsius
-
Note: Plate cultures should be incubated in 5% carbon dioxide. It takes 3-7 days to form colonies on plates.
C. Diagnostic Tests
:
-
Organism Detection Tests:
-
Microscopy (Bannatyne et al., 1997, Rich et al., 2000):
-
Description: The BACTEC 9240 continuous monitoring system uses broth to culture bacteria from human blood samples; after culturing the samples are stained with Gram's stain and observed using light microscopy; suspicious cultures are tested with further biochemical tests.
-
False Positive: Visual detection is subjective, and non-Brucella samples may be identified as suspicious for Brucella.
-
False Negative: Brucella are fastidious and slow growing organisms which may fail to grow in synthetic media, resulting in a false negative culture.
-
Direct Urease Test (Rich et al., 2000):
-
Description: Detection of urease activity in bacteria grown in blood culture broth can support suspicions of Brucella.
-
False Positive: Many bacteria are urease positive.
-
False Negative: Not all Brucella species are urease positive.
-
Immunoassay Tests:
-
Coombs Test (Orduna et al., 2000, Bercovich, 1998):
-
Description: The Coombs Test is a diagonostic test using manufactured antigen and antiglobulins to detect the presence of specific antibodies. It is used very commonly in the detection of human brucellosis, but due to expense and time factors is used less often to detect animal brucellosis.
-
False Positive: specificity of the Coombs test is reportedly ranges from 96.2 % to 99.8%
-
False Negative: Sensitivity of the Coombs test is reported to be 91.5%.
-
The complement fixation test (Bercovich, 1998):
-
Description: The complement fixation test (CFT), used to diagnose brucellosis in cattle, detects specific IgM and IgG1 antibodies.
-
False Positive: specificity of this test is reported to be 98%.
-
False Negative: Sensitivity of this test is reported to be 81%.
-
Competitive ELISA (Lucero et al., 1999, Diaz-Aparicio et al., 1994):
-
Description: Competitive ELISA detects serum antibody and is able to distinguish between vaccine and infection derived antibodies. ELISA is used for detection of brucellosis in humans, cattle, sheep and goats.
-
False Positive: specificity of this test is reported to be between 60% and 96.5%.
-
False Negative: Sensitivity of this test is reported to be between 94 % and 94.8%.
-
A radial immunodiffusion (RID) test (Diaz-Aparicio et al., 1994):
-
Description: A radial immunodiffusion (RID) test uses manufactured Brucella antigens in a gelling agent with wells for goat serum. Sera positive for antibodies to Brucella will diffuse into the gelling agent and cause a visible color change.
-
False Positive: RID tests are reported to have a 95% specificity for subcutaneously vaccinated sheep and a 100% specificity 120 days after conjunctival vaccination.
-
False Negative: RID tests are reported to have sensitivity ranging between 53.0% and 94.5%.
-
Counter immunoelectrophoresis (Diaz-Aparicio et al., 1994):
-
Description: Counter immunoelectrophoresis (CIEP) is used to detect brucellosis in goats. Manufactured antigen binds with antibodies present in sera and the combination is electrophoresed to analyze antibody titers.
-
False Positive: CIEP is reported to have a specificity of 90%.
-
False Negative: CIEP is reported to have sensitivity of 93%.
-
Milk Ring Test (MRT) (Bercovich, 1998):
-
Description: The milk ring test is a serological test for lacteal anti-Brucella IgM and IgA bound to milk fat globules in cow or goat milk.
-
False Positive: False positives may occur with this test in colostrum, milk at the end of a lactation period, or cows suffering from a hormonal disorder or mastitis; however the specificity is reported to be 99%.
-
False Negative: False negatives may occur with this test in milk with a low concentration of lacteal antibodies or lacking fat-clustering factors; the sensitivity is reported to be 56%.
-
Brucellacapt (Orduna et al., 2000):
-
Description: Brucellacapt is an immunocapture agglutination test for the serodiagnosis of human brucellosis.
-
False Positive: specificity for the Brucellacapt test is reported to be between 81.5 % and 99.0%.
-
False Negative: Sensitivity for the Brucellacapt test is reported to be 95.1%.
-
Serum Agglutination Test (SAT) (Bercovich, 1998, Orduna et al., 2000):
-
Description: The Serum agglutination test (SAT) is used commonly in the detection of both human and bovine Brucella specific antibodies.
-
False Positive: The SAT is reported to have specificity between 95% and 100%.
-
False Negative: The SAT is reported to have sensitivity between 70% and 91.5%.
-
Rose Bengal Test (RB) (Bercovich, 1998, Diaz-Aparicio et al., 1994):
-
Description: The RB test is a spot agglutination technique that uses dyed B. abortus antigen to detect serum antibodies of bovine brucellosis.
-
False Positive: Specificity of the RB test is reported to be between 71% and 80%.
-
False Negative: Sensitivity of the RB test is reported to be between 78% and 100%.
-
2-Mercapto-ethanol Test (2-ME) (Bercovich, 1998):
-
Description: The 2ME test is usually used in serial testing to distinguish between vaccinated and infected cattle.
-
False Positive: Specificity of the 2-ME test is reported to be 97%.
-
False Negative: Sensitivity of the 2-ME test is reported to be 56%.
-
Skin Delayed-Type Hypersensitivity Test (SDTH) (Bercovich, 2000):
-
Description: The SDTH test uses manufactured brucellin to elicit a skin hypersensitivity in livestock infected with acute, chronic, or latent brucellosis.
-
False Positive: Specificity of the SDTH test is reported to be 93.9%.
-
Dipstick Assay (Smits et al., 1999):
-
Description: A dipstick assay for rapid detection of Brucella specific immunoglobulin uses manufactured Brucella antigen on a nitrocellulose strip. When incubated for three hours with a serum sample, positive samples will form a distinct line, which can be graded from 1-4.
-
False Positive: Specificity of the dipstick assay is reported to be 98.6%.
-
False Negative: Sensitivity of the dipstick assay is reported to range from 89.0% at 0-2 months after the onset of the disease to 29.8% at 6 or more months after the onset of the disease.
-
Nucleic Acid Detection Tests:
:
-
AMOS (Bricker et al., 1994):
-
Time to Perform:
1-hour-to-1-day
-
Description:
Several PCR assays which identify the genus Brucella but do not discriminate among species have been reported. We describe a PCR assay that comprises five oligonucleotide primers which can identify selected biovars of four species of Brucella. Individual biovars within a species are not differentiated. The assay can identify three biovars (1, 2, and 4) of B. abortus, all three biovars of B. melitensis, biovar 1 of B. suis, and all B. ovis biovars. These biovars include all of the Brucella species typically isolated from cattle in the United States, a goal of the present research. The assay exploits the polymorphism arising from species-specific localization of the genetic element IS711 in the Brucella chromosome. Identity is determined by the size(s) of the product(s) amplified from primers hybridizing at various distances from the element. The performance of the assay with U.S. field isolates was highly effective. When 107 field isolates were screened by the described method, there was 100% agreement with the identifications made by conventional methods. Six closely related bacteria (Agrobacterium radiobacter, Agrobacterium rhizogenes, Ochrobactrum anthropi, Rhizobium leguminosarum, Rhizobium meliloti, and Rhodospirillum rubrum) and two control bacteria (Bordetella bronchiseptica and Escherichia coli) tested negative by the assay (Bricker et al., 1994).
-
Primers:
-
B. abortus specific primers
-
Forward:
GACGAACGGAATTTTTCCAATCCC
-
Reverse:
TGCCGATCACTTAAGGGCCTTCAT
-
Product
-
Size: 498bp for field strains
-
B. melitensis specific primers
-
Forward:
AAATCGCGTCCTTGCTGGTCTGA
-
Reverse:
TGCCGATCACTTAAGGGCCTTCAT
-
Product
-
Size: 731bp for all three biovars
-
B. ovis specific primers
-
Forward:
CGGGTTCTGGCACCATCGTCG
-
Reverse:
TGCCGATCACTTAAGGGCCTTCAT
-
Product
-
B. suis specific primers
-
Forward:
GCGCGGTTTTCTGAAGGTTCAGG
-
Reverse:
TGCCGATCACTTAAGGGCCTTCAT
-
Product
-
False Positive:
Six closely related bacteria (Agrobacterium radiobacter, Agrobacterium rhizogenes, Ochrobactrum anthropi, Rhizobium leguminosarum, Rhizobium meliloti, and Rhodospirillum rubrum) and two control bacteria (Bordetella bronchiseptica and Escherichia coli) tested negative by the assay (Bricker et al., 1994).
-
False Negative:
When 107 randomly selected isolates of Brucella from the US were tested, all 107 gave the predicted results (Bricker et al., 1994).
-
Updated AMOS (Bricker et al., 1994, Bricker et al., 1995):
-
Time to Perform:
1-hour-to-1-day
-
Description:
Distinguishing vaccine strains from strains that cause infections among vaccinated herds in the field is essential. To accomplish this, the PCR-based, species-specific AMOS assay (B. J. Bricker and S. M. Halling, J. Clin. Microbiol. 32:26602666, 1994) was updated to identify Brucella abortus vaccine strains S19 and RB51. Three new oligonucleotide primers were added to the five-primer multiplex Brucella AMOS PCR assay. Identification is based on the number and sizes of six products amplified by PCR (Bricker et al., 1994, Bricker et al., 1995).
-
Primers:
-
B. abortus specific primers
-
Forward:
GACGAACGGAATTTTTCCAATCCC
-
Reverse:
TGCCGATCACTTAAGGGCCTTCAT
-
Product
-
Size: 498bp for field strains
-
B. melitensis specific primers
-
Forward:
AAATCGCGTCCTTGCTGGTCTGA
-
Reverse:
TGCCGATCACTTAAGGGCCTTCAT
-
Product
-
Size: 731bp for all three biovars
-
B. ovis specific primers
-
Forward:
CGGGTTCTGGCACCATCGTCG
-
Reverse:
TGCCGATCACTTAAGGGCCTTCAT
-
Product
-
B. suis specific primers
-
Forward:
GCGCGGTTTTCTGAAGGTTCAGG
-
Reverse:
TGCCGATCACTTAAGGGCCTTCAT
-
Product
-
RB51/2308 primer
-
Forward:
CCCCGGAAGATATGCTTCGATCC
-
Reverse:
TGCCGATCACTTAAGGGCCTTCAT
-
Product
-
Size: 364-bp for strains 2308 and RB51, and 498-bp for other B. abortus
-
eri primers
-
Forward:
GCGCCGCGAAGAACTTATCAA
-
Reverse:
CGCCATGTTAGCGGCGGTGA
-
Product
-
False Positive:
Six closely related bacteria (Agrobacterium radiobacter, Agrobacterium rhizogenes, Ochrobactrum anthropi, Rhizobium leguminosarum, Rhizobium meliloti, and Rhodospirillum rubrum) and two control bacteria (Bordetella bronchiseptica and Escherichia coli) tested negative by the assay (Bricker et al., 1994).
All 100 isolates tested produced only the predicted 498-bp B. abortus product. One of these isolates (NADC 1035) initially failed to produce an amplified product, but upon retesting the predicted product was amplified. The 364-bp product was amplified from only B. abortus 2308 and RB51, suggesting that adjacent copies of IS711 are not commonly found in B. abortus. However, B. ovis, which has at least 30 copies of IS711, does appear to have a similar arrangement of tandem elements. As a result, B. ovis also amplifies a 364-bp product (data not shown). Because this product is so much smaller than the 976-bp product designed specifically for this species, we observed that the 364-bp product is sometimes preferentially amplified at the expense of the larger product. This does not confuse the identification of species, however, because B. ovis does not amplify the 498-bp product typical of B. abortus strains (Bricker et al., 1995).
-
False Negative:
When 107 randomly selected isolates of Brucella from the US were tested, all 107 gave the predicted results (Bricker et al., 1994).
-
Single step PCR (Casanas et al., 2001, Morata et al., 2001, Quiepo-Ortuno et al., 1997):
-
Time to Perform:
1-hour-to-1-day
-
Description:
Single step PCR for the detection of a 223 bp region encoding Brucella abortus protein BCSP31 in peripheral blood samples is used in the diagnosis of human brucellosis (Casanas et al., 2001, Quiepo-Ortuno et al., 1997).
The same PCR test can also be used for samples from focal lesions (Morata et al., 2001).
-
Primers:
-
31 kDa protein
-
Forward:
TGGCTCGGTTGCCAATATCAA
-
Reverse:
CGCGCTTGCCTTTCAGGTCTG
-
Product
-
False Positive:
This test may cross react with Ochrobactrum species. Specificity reported during a 1997 study was claimed to be 98.3%. Specificity for samples from focal lesions is 93.8% (Casanas et al., 2001)
-
False Negative:
Sensitivity was reported in a 1997 study to be 100% based on 50 brucellosis patients and 60 control samples (Quiepo-Ortuno et al., 1997).
Sensitivity for samples from focal lesions is 97% (Morata et al., 2001).
-
PCR for B. abortus vaccine RB51 detection (Vemulapalli et al., 1999):
-
Time to Perform:
1-hour-to-1-day
-
Description:
Brucella abortus vaccine strain RB51 is a natural stable attenuated rough mutant derived from the virulent strain 2308. The genetic mutations that are responsible for the roughness and the attenuation of strain RB51 have not been identified until now. It was demonstrated that the wboA gene encoding a glycosyltransferase, an enzyme essential for the synthesis of O antigen, is disrupted by an IS711 element in B. abortus vaccine strain RB51. The PCR assay developed here can distinguish strain RB51 from all other Brucella species and strains tested (Vemulapalli et al., 1999).
-
Primers:
-
The wboA gene
-
Forward:
TTAAGCGCTGATGCCATTTCCTTCAC
-
Reverse:
GCCAACCAACCCAAATGCTCACAA
-
Product
-
Size: ~1300 bp for RB51, and ~400 bp for all other Brucella species with intact wboA gene
-
The wboA gene with part of IS711
-
Forward:
TTTAGTTTGCCGTAATATAGGTCTAGAACCTGTC
-
Reverse:
GCCAACCAACCCAAATGCTCACAA
-
Product
-
False Positive:
No amplified products were detectable when the template was genomic DNA from bacteria that are closely related to Brucella species, Ochrobactrum anthropi 49237 and 49188, and Yersinia enterocolitica O:9 (Vemulapalli et al., 1999).
-
False Negative:
No false negative results have been found (Vemulapalli et al., 1999).
-
Real-time PCR Detection (Newby et al., 2003):
-
Time to Perform:
1-hour-to-1-day
-
Description:
A number of different approaches can be used to generate the fluorescence signal. Three approachesSYBR Green I (a double-stranded DNA intercalating dye), 5-exonuclease (enzymatically released fluors), and hybridization probes (fluorescence resonance energy transfer)were evaluated for use in a real-time PCR assay to detect Brucella abortus. The three assays utilized the same amplification primers to produce an identical amplicon. This amplicon spans a region of the B. abortus genome that includes portions of the alkB gene and the IS711 insertion element. All three assays were of comparable sensitivity, providing a linear assay over 7 orders of magnitude (from 7.5 ng down to 7.5 fg). However, the greatest specificity was achieved with the hybridization probe assay (Newby et al., 2003).
-
Primers:
-
Primers
-
Forward:
CCATTGAAGTCTGGCGAGC
-
Reverse:
CGATGCGAGAAAACATTGACCG
-
Real-time-probe:
5-FAM-GCATGCGCTATGATCTGGTTACGTT-(TAMRA)-35-TGCGCTATGATCTGGTTACG-(FAM)5-(CY5.5)-AAATGCAGACACGCCCTA-(P)-3
-
Product
-
Size: 156bp with BAF and BAR primers
-
False Positive:
Agarose gel electrophoretic analysis of the amplicons provided further evidence of the lack of specificity of the SYBR Green I assay, because heterogeneous products were observed, except for those generated from authentic B. abortus templates. The 5-exonuclease assay demonstrated improved specificity compared to the SYBR Green I assay, since it did not detect any of the closely related genera. However, both B. canis templates generated fluorescence signals. The hybridization probe assay was the most specific, with only one of the two B. canis strains tested giving positive amplification results and only when present at concentrations greater than 10 pg (Newby et al., 2003).
-
False Negative:
All three assays demonstrated similar sensitivity when using genomic B. abortus from NADC strain 1144 as a template, with a linear assay over 7 orders of magnitude (from 7.5 ng down to 7.5 fg) (Newby et al., 2003).
-
PCR for 16S rRNA Detection (Romero et al., 1995):
-
Time to Perform:
1-hour-to-1-day
-
Description:
This is a PCR assay with primers derived from the 16S rRNA sequence of Brucella abortus. The pair of primers chosen amplified a 905bp fragment. As little as 80 fg of Brucella DNA was detected by this method. DNAs from all of the representative strains of the species and biovars of Brucella and from 23 different Brucella isolates were analyzed and yielded exclusively the 905-bp fragment. No amplification was detected with DNAs from 10 strains phylogenetically related to Brucella spp., 5 gram-negative bacteria showing serological cross-reactions with Brucella spp., and 36 different clinical isolates of non-Brucella species. Only Ochrobactrum anthropi biotype D yielded a PCR product of 905 bp, suggesting a closer relationship between Brucella spp. and O. anthropi biotype D. The specificity and high sensitivity of the PCR assay may provide a valuable tool for the diagnosis of brucellosis (Romero et al., 1995).
-
Primers:
-
16S rRNA
-
Forward:
TCGAGCGCCCGCAAGGGG
-
Reverse:
AACCATAGTGTCTCCACTAA
-
Product
-
False Positive:
Ochrobactrum anthropi LMG 3301 yielded a PCR product of 905bp (Romero et al., 1995).
-
False Negative:
No false negative results have been found (Romero et al., 1995).
-
PCR for Detection of Gene encoding OMP-2 (Leal-Klevezas et al., 1995):
-
Time to Perform:
1-hour-to-1-day
-
Description:
A versatile method for the extraction of Brucella DNA and PCR are presented as reliable tools for the detection of Brucella spp. from body fluids of infected animals. Two oligonucleotides homologous to regions of the gene encoding for an outer membrane protein (OMP-2) were designed to detect the pathogen from milk and/or blood of infected goats, bovine, and human patients. The sensitivity of our test and its ability to detect the pathogen in samples from the field reveal a promising advance in the diagnosis of brucellosis in animals and humans (Leal-Klevezas et al., 1995).
-
Primers:
-
outer membrane protein OMP-2
-
Forward:
GCGCTCAGGCTGCCGACGCAA
-
Reverse:
ACCAGCCATTGCGGTCGGTA
-
Product
-
False Positive:
No amplification signal was detected when DNAs extracted from E. coli, V. cholerae O1, or Y. enterocolitica O:3 and O:9 or the closely related bacteria R. loti, A. tumefaciens, and O. anthropi (Leal-Klevezas et al., 1995).
-
False Negative:
No false negative results have been found. It is a highly sensitive assay (Leal-Klevezas et al., 1995).
-
Whole-Cell Hybridization Assay (Fernandez-Lago et al., 2000):
-
Description: Three fluorescent oligonucleotide probes from the 16S rRNA sequence of Brucella are used to diagnose human brucellosis.
-
False Positive: False positive reactions to this test may occur due to phylogenetically similar bacteria.
-
Other Types of Diagnostic Tests:
No other tests available here.
V. References
A. Journal References:
Baldwin et al., 1994:
Baldwin CL,
Winter AJ Macrophages and Brucella.
Immunology Series.
1994;
60:
363 -
380.
[PubMed:
8251581].
Bannatyne et al., 1997:
Bannatyne RM,
Jackson MC,
Memish Z Rapid diagnosis of Brucella bacteremia using the BACTEC 9240 system..
Journal of Clinical Microbiology.
1997;
35(10):
2673 -
2674.
[PubMed:
9316932].
Bercovich, 1998:
Bercovich Z Maintenance of Brucella abortus free herds: A review with emphasis on epidemiology and the problems of diagnosing brucellosis in areas of low prevalence..
Veterinary Quarterly.
1998;
20(3):
81 -
88.
[PubMed:
9684294].
Bercovich, 2000:
Bercovich Z The use of skin delayed-type hypersensitivity as an adjunct test to diagnose brucellosis in cattle: A review..
Veterinary Quarterly.
2000;
22(3):
123 -
130.
[PubMed:
10952440].
Blasco et al., 1997:
Blasco JM A review of the use of B. melitensis Rev 1 vaccine in adult sheep and goats..
Preventive Veterinary Medicine.
1997;
31(3-4):
275 -
283.
[PubMed:
9234451].
Boschiroli et al., 2001:
Boschiroli ML,
Foulongne V,
O'Callaghan D Brucellosis: a worldwide zoonosis.
Current Opinion in Microbiology.
2001;
4(1):
58 -
64.
[PubMed:
11173035].
Bricker et al., 1994:
Bricker BJ,
Halling SM Differentiation of Brucella abortus bv. 1, 2, and 4, Brucella melitensis, Brucella ovis, and Brucella suis bv. 1 by PCR.
J Clin Microbiol.
1994;
32(11):
2660 -
2666.
[PubMed:
7852552].
Bricker et al., 1995:
Bricker BJ,
Halling SM Enhancement of the Brucella AMOS PCR assay for differentiation of Brucella abortus vaccine strains S19 and RB51.
J Clin Microbiol.
1995;
33(6):
1640 -
1642.
[PubMed:
7650203].
Casanas et al., 2001:
Casanas MC,
Quiepo-Ortuno MI,
Rodriguez-Torres A,
Orduna A,
Colmenero JD,
Morata P Specificity of a polymerase chain reaction assay of a target sequence on the 31-kilodalton Brucella antigen DNA used to diagnose human brucellosis..
European Journal of Clinical Microbiology of Infectious Disease.
2001;
20(2):
127 -
131.
[PubMed:
11305467].
Cheville, 2000:
Cheville NF Development, testing and commercialization of a new brucellosis vaccine for cattle.
.
Ann N Y Acad Sci..
2000;
916():
147 -
153.
[PubMed:
11193615].
Corbel, 1997:
Corbel MJ Editorial: Recent advances in brucellosis..
Journal of Medical Microbiology.
1997;
46(2):
101 -
103.
[PubMed:
9060868].
Diaz-Aparicio et al., 1994:
Diaz-Aparicio E,
Marin C,
Alonso-Urmeneta B,
Aragon V,
Perez-Ortiz S,
Pardo M,
Blasco JM,
Diaz R,
Moriyon I Evaluation of serological tests for diagnosis of Brucella melitensis infection of goats..
Journal of Clinical Microbiology.
1994;
32(5):
1159 -
1165.
[PubMed:
8051240].
Edmonds et al., 1999:
Edmonds MD,
Schurig G,
Samartino LE,
Hoyt PG,
Walker JV,
Hagius SD,
Elzer PH Biosafety of Brucella abortus strain RB51 for vaccination of mature bulls and pregnant heifers..
American Journal of Veterinary Research.
1999;
60(6):
722 -
725.
[PubMed:
10376900].
Fernandez-Lago et al., 2000:
Fernandez-Lago L,
Vallejo FJ,
Trujillano I,
Vizcaino N Fluorescent whole-cell hybridization with 16S rRNA targeted oligonucleotide probes to identify Brucella spp. by flow cytometry..
Journal of Clinical Microbiology.
2000;
38(7):
2768 -
2771.
[PubMed:
10878084].
Gandara et al., 2001:
Gandara B.,
Merino AL,
Rogel MA,
Martinez-Romero E Limited genetic diversity of Brucella species.
Journal of Clinical Microbiology.
2001;
39(1):
235 -
240.
[PubMed:
11136777].
Kohler et al., 2002:
Kohler S,
Porte F,
Jubier-Maurin V, Ouahrani-Bettache S, Teyssier J, Liautard JP. he intramacrophagic environment of Brucella suis and bacterial response.
Vet Microbiol.
2002;
90(14):
299 -
309.
[PubMed:
12414150].
Leal-Klevezas et al., 1995:
Leal-Klevezas DS,
Martinez-Vazquez IO,
Lopez-Merino A, Martinez-Soriano JP. Single-step PCR for detection of Brucella spp. from blood and milk of infected animals.
J Clin Microbiol.
1995;
33(12):
3087 -
3090.
[PubMed:
8586678].
Lord et al., 1998:
Lord VR,
Schurig GG,
Cherwonogrodzky JW,
Marcano MJ,
Melendez GE Field study of vaccination of cattle with Brucella abortus strains RB51 and 19 under high and low disease prevalence..
American Journal of Veterinary Research.
1998;
59(8):
1016 -
1020.
[PubMed:
9706206].
Lucero et al., 1999:
Lucero NE,
Foglia L,
Ayala SM,
Gall D,
Nielsen K Competetive enzyme immunoassay for diagnosis of human brucellosis.
Journal of Clinical Microbiology.
1999;
37(10):
3245 -
3248.
[PubMed:
10488186].
Morata et al., 2001:
Morata P,
Quiepo-Ortuno MI,
Reguera JM,
Miralles F,
Lopez-Gonzalez JJ,
Colmenero JD Diagnostic yield of a PCR assay in focal complications of brucellosis.
Journal of Clinical Microbiology.
2001;
39(10):
3743 -
3746.
[PubMed:
11574607].
Morenoa et al., 2002:
Morenoa E,
Cloeckaertb A,
Moriyn I Brucella evolution and taxonomy.
Vet Microbiol.
2002;
90(14):
209 -
227.
[PubMed:
12414145].
Newby et al., 2003:
Newby DT, Hadfield TL, Roberto FF. Real-time PCR detection of Brucella abortus: a comparative study of SYBR green I, 5'-exonuclease, and hybridization probe assays..
Appl Environ Microbiol.
2003;
69(8):
4753 -
4759.
[PubMed:
12902268].
Nicoletti, 1980:
Nicoletti P The Epidemiology of Bovine Brucellosis.
Advances in Veterinary Science and Comparative Medicine.
1980;
24:
69 -
98.
[PubMed:
6779513].
Orduna et al., 2000:
Orduna A,
Almarez A,
Prado A,
Gutierrez MP,
Garcia-Pascual A,
Duenas A,
Cuervo M,
Abad R,
Hernandez B,
Lorenzo B,
Bratos MA,
Rodriguez-Torres A Evaluation of an immunocapture-agglutination test (Brucellacapt) for serodiagnosis of human brucellosis.
Journal of Clinical Microbiology.
2000;
38(11):
4000 -
4005.
[PubMed:
11060059].
Paulsen, 2002:
Paulsen IT,
Seshadri R,
Nelson KE, Eisen JA, Heidelberg JF, Read TD, Dodson RJ, Umayam L, Brinkac LM, Beanan MJ, Daugherty SC, Deboy RT, Durkin AS, Kolonay JF, Madupu R, Nelson WC, Ayodeji B, Kraul M, Shetty J, Malek J, Van Aken SE, Riedmuller S, Tettelin H, Gill SR, White O, Salzberg SL, Hoover DL, Lindler LE, Halling SM, Boyle SM, Fraser CM. The Brucella suis genome reveals fundamental similarities between animal and plant pathogens and symbionts.
PNAS.
2002;
99(20):
13148 -
13153.
[PubMed:
8562733].
Quiepo-Ortuno et al., 1997:
Quiepo-Ortuno MI,
Morata P,
Ocon P,
Manchado P,
Colmenero Juan de Dios Rapid diagnosis of human brucellosis by peripheral-blood PCR assay..
Journal of Clinical Microbiology.
1997;
35(11):
2927 -
2930.
[PubMed:
9350761].
Radwan et al., 1993:
Radwan AI, Bekairi SI, al-Bokmy AM, Prasad PV, Mohamed OM, Hussain ST. Successful therapeutic regimens for treating Brucella melitensis and Brucella abortus infections in cows..
Rev Sci Tech.
1993;
12(3):
909 -
922.
[PubMed:
8219341].
Rich et al., 2000:
Rich M,
Bannatyne RM,
Memish ZA Letter to the Editor Direct Urease test on BACTEC blood cultures: Early presumptive diagnosis of Brucellosis in an area of endemicity..
Journal of Clinical Microbiology.
2000;
38(4):
1706 -
1706.
[PubMed:
10819622].
Romero et al., 1995:
Romero C,
Gamazo C,
Pardo M, Lopez-Goni I. Specific detection of Brucella DNA by PCR.
Clin Diagn Lab Immunol.
1995;
33(3):
615 -
617.
[PubMed:
7538508].
Schurig et al., 2002:
Schurig GG,
Sriranganathan N,
Corbel MJ Brucellosis vaccines: past, present and future.
Vet Microbiol.
2002;
90(14):
479 -
496.
[PubMed:
12414145].
Shamelian, 2000:
Shamelian SOA Diagnosis and treatment of brucellosis..
The Netherlands Journal of Medicine.
2000;
56(5):
198 -
200.
[PubMed:
10781713].
Smits et al., 1999:
Smits HL,
Basahi MA,
Diaz R, Marrodan T, Douglas JT, Rocha A, Veerman J, Zheludkov MM, Witte OW, de Jong J, Gussenhoven GC, Goris MG, van Der Hoorn MA. Development and evaluation of a rapid dipstick assay for serodiagnosis of acute human brucellosis.
Journal of Clinical Microbiology.
1999;
37(12):
4179 -
4182.
[PubMed:
10565959].
Uzal et al., 2000:
Uzal FA,
Samartino L,
Schurig G,
Carrasco A,
Nielsen K,
Cabrera RF,
Taddeo HR Effect of vaccination with Brucella abortus strain RB51 on heifers and pregnant cattle..
Veterinary Research Communications.
2000;
24(3):
143 -
151.
[PubMed:
10836273].
Vemulapalli et al., 1999:
Vemulapalli R,
McQuiston JR,
Schurig GG, Sriranganathan N, Halling SM, Boyle SM. Identification of an IS711 element interrupting the wboA gene of Brucella abortus vaccine strain RB51 and a PCR assay to distinguish strain RB51 from other Brucella species and strains.
Clin Diagn Lab Immunol.
1999;
6(5):
760 -
764.
[PubMed:
10473532].
Yagupsky, 1999:
Yagupsky P MInireview: Detection of brucellae in blood cultures.
Journal of Clinical Microbiology.
1999;
37(11):
3437 -
3442.
[PubMed:
10523530].
Young, 1995:
Young EJ An overview of human brucellosis.
Clinical Infectious Diseases.
1995;
21:
283 -
289.
[PubMed:
8562733].
B. Book References:
Alton et al., 1988:
Alton GG,
Jones LM,
Angus RD,
Verger JM In: techniques for the brucellosis laboratory1988.
Institut National De La Recherche Agronomique,
Paris.
Garcia-Carrillo, 1990:
Garcia-Carrillo C In: Animal and Human Brucellosis in the Americas1990.
Office International Des Epizooties,
Paris.
Ministry of Agriculture and Fisheries, 1977:
Ministry of Agriculture and Fisheries In: Elliot REW,
Christiansen KH Brucellosis: A Veterinarian's Guide to the Literature1977.
Animal Health Division, Ministry of Agriculture and Fisheries,
New Zealand.
C. Website References:
Website 1:
Microbial Genomes Blast Database TIGR [
http://www.ncbi.nlm.nih.gov/Microb_blast/credits/29461.html
].
Website 2:
CDC Final Rule on Facilities for transferring or receiving select agents [
http://www.cdc.gov/od/sap/42cfr72.htm
].
Website 3:
CDC and OHS Agent Summary Statements [
http://www.cdc.gov/od/ohs/biosfty/bmbl4/bmbl4s7a.htm#Agent:%20Brucella%20(B.%20abortus,%20B.%20canis,%20B.%20melitensis,%20B.%20suis)
].
Website 4:
CDC Basic Laboratory Protocols for the Presumptive Identification of Brucella Species [
http://www.ohd.hr.state.or.us/phl/bt/brucella/levelaprocedures.pdf
].
Website 5:
The Development of New/Improved Brucellosis Vaccines:
Report of WHO Meeting [
http://www.who.int/emc-documents/zoonoses/docs/whoemczdi9814.pdf
].
Website 6:
Brucella species as Bioterrorist Agents [
http://www.ohd.hr.state.or.us/bioterrorism/brucella.pdf
].
Website 7:
Candada LABORATORY CENTRE FOR DISEASE CONTROL
MATERIAL SAFETY DATA SHEET - INFECTIOUS SUBSTANCES [
http://www.hc-sc.gc.ca/pphb-dgspsp/msds-ftss/msds23e.html
].
Website 8:
List of Bacterial Names with Standing in Nomenclature
[
http://www.bacterio.cict.fr/alac.html
].
Website 9:
Health Department, Kansas City. Bioterrorism: Threats and Events: Chapter 6, Brucellosis [
http://www.kcmo.org/health/pdf/chapter6.pdf
].
Website 11:
Virtual Naval Hospital book of Military Medicine: Medical Aspects of Chemical and Biological Warfare: Chapter 25 Brucellosis [
http://www.vnh.org/MedAspChemBioWar/chapters/chapter_25.htm
].
Website 12:
NCBI Brucella melitensis complete genome Chromosome I [
http://www.ncbi.nlm.nih.gov/genomes/framik.cgi?gi=224&db=Genome
].
Website 13:
NCBI Brucella melitensis complete genome Chromosome II [
http://www.ncbi.nlm.nih.gov/genomes/framik.cgi?gi=225&db=Genome
].
Website 14:
Views of Brucella Through a Microscope [
http://www.cvgs.k12.va.us/brucella/Bac_Analysis/micro.htm
].
Website 15:
Brucellosis in wildlife [
http://www.oie.int/eng/publicat/rt/2102/GODFROID.pdf
].
Website 16:
Dennis Kunkel Microscopy, Inc. [
http://www.denniskunkel.com/
].
D. Thesis References:
Buhrman, 1989:
Buhrman DL; .
The Behavior and Effects of Brucella abortus Rough Strain RB51 In Mice and Cattle.
1989.
PhD degree.
Virginia Polytechnic Institute and State University.
Blacksburg, VA.
VI. Curation Information
-
Curators:
Yongqun He (yohe@vt.edu); Sarah Sheckels; Raju Lathigra
-
Date: 1/10/2005
-
Version: 1.0
-
Note: This is the first version of the Brucella background information
-
Contact information:
- Email: pathinfo@vbi.vt.edu