Escherichia coli O157:H7

I. Organism Information

A. Taxonomy Information
  1. Species:
    1. Escherichia coli O157:H7. :
      1. GenBank Taxonomy No.: 83334
      2. Description: The microorganisms which inhabit the intestinal tract as normal flora are named enteric bacteria. E. coli belongs to the Family Enterobacteriaceae (from the Greek word enterikos, which pertains to the intestine). The name Escherichia comes from the name of the person Escherich, who in 1885 first isolated and characterized this bacterium. E. coli is a normal inhabitant of the intestines of all animals, including humans. When aerobic culture methods are used, E. coli is the dominant species found in feces (Karmali et al., 1983 ). Normally E. coli serves a useful function in the body by suppressing the growth of harmful bacterial species and by synthesizing appreciable amounts of vitamins. A minority of E. coli strains are capable of causing human illness by several different mechanisms. E. coli serotype O157:H7 is a rare variety of E. coli that produces large quantities of one or more related, potent toxins that cause severe damage to the lining of the intestine (Fegan and Desmarchelier, 1999, Fegan and Desmarchelier, 2002 ). The recognition of EHEC (Enterohemorrhagic Escherichia coli) as a pathogenic E. coli resulted from two key epidemiologic observations. The first was the 1983 report by Riley et al (Riley et al., 1983). who investigated two outbreaks of a distinctive gastrointestinal illness characterized by severe crampy abdominal pain, watery diarrhea followed by grossly bloody diarrhea, and little or no fever. This illness, designated hemorrhagic colitis (HC), was associated with the ingestion of undercooked hamburgers at a fast-food restaurant chain (Riley et al., 1983, Fegan and Desmarchelier, 2002 , Rasmussen and Casey, 2001 ).
B. Lifecycle Information :
  1. E. coli lifecycle one stage (Bopp et al., 1987 , Kim et al., 1994 ):
    1. Shape: E. coli are rod-shaped bacteria.
    2. Picture(s):
      1. SEM Image of E. coli on the surface of the Small Intestine (Website 68):



        Description: Photocomposite - E. coli on the surface of the small intestine. E. coli - Gram-negative, facultatively anaerobic, rod prokaryote. Part of human and animal microbiota. E. coli can cause urinary tract infections, traveler's diarrhea and nosocomial infections. Magnification: bacteria x 800; intestine x49.
      2. TEM Image of E. coli with fimbriae (Website 68):



        Description: Transmission Electron Micrograph of E. coli with fimbriae on the cell surface. Magnification: x6,105.
      3. SEM Image of E. coli strain 0157:H7 - rod prokaryote (hemorrhagic bacterium) (Website 68):



        Description: Scanning Electron Micrograph of E. coli strain 0157:H7 hemorrhagic type. Gram-negative, enteric, facultatively anaerobic, rod prokaryote. Potentially fatal to humans, contracted when contaminated meat is cooked inadequately. Magnification: x2,925.
    3. Other:
      1. E. coli E. coli O157:H7 is a gram-negative bacillus. The O refers to the somatic antigen and the H to the flagellar antigen (the somatic antigens (or O antigens) of gram-negative bacteria are component of lipopolysaccharide (LPS), flagella are filamentous protein structures attached to the bacterial cell that provide bacterial swimming ). The majority of E. coli O157:H7 strains can be distinguished from most E. coli by their inability to ferment sorbitol rapidly and by their lack of production of glucuronidase (Hayes et al., 1995, Doyle and Schoeni, 1984). The attempts to subtype E. coli strains have demonstrated the heterogeneity, which is consistent with the emergence and spread of new, clonally derived pathogens ( Donnenberg and Whittam, 2001 ).
C. Genome Summary:
  1. Genome of Escherichia coli O157:H7.
    1. Description: E. coli O157:H7 has a `backbone' sequence of about 4.1 Mb that is co-linear. The `backbone' is punctuated by hundreds of islands of apparently introgressed DNA designated `O-islands' for DNA segments. Of the O-islands, only 40% could be assigned a function (Perna et al., 2001 , Hayashi et al., 2001 ).
    2. E. coli O157:H7 EDL933 Chromosome (Website11):
      1. GenBank Accession Number: AE005174
      2. Size: 5.5 Mb (Perna et al., 2001 ).
      3. Gene Count: 5361 open reading frames (Hayashi et al., 2001 ).
      4. Description: Escherichia coli O157:H7 EDL933, complete genome (Perna et al., 2001 ).
    3. Escherichia coli O157:H7 Chromosome (Website12):
      1. GenBank Accession Number: BA000007
      2. Size: 5.5 Mb (Hayashi et al., 2001 ).
      3. Gene Count: 5361 open reading frames (Hayashi et al., 2001 ).
      4. Description: Escherichia coli O157:H7, complete genome (Hayashi et al., 2001 ).
    4. 92 kb F-like plasmid (Website13):
      1. GenBank Accession Number: NC_002128
      2. Size: 92 kb (Boyce et al., 1995 ).
      3. Gene Count: 100 open reading frames (Burland et al., 1998 ).
      4. Description: The 92 kb F-like plasmid is composed of segments of putative genes in a framework of replication and maintenance regions, with seven insertion sequence elements. The coding regions account for 87% of the plasmid (Burland et al., 1998 ).
    5. A cryptic plasmid pOSAK1 (Website14):
      1. GenBank Accession Number: NC_002127
      2. Size: 3.3 kb (Makino et al., 1998 ).
      3. Gene Count: 3 open reading frames (Makino et al., 1998 ).
      4. Description: A cryptic plasmid pOSAK1 (Makino et al., 1998 ).

II. Epidemiology Information

A. Outbreak Locations:
  1. Both outbreaks and sporadic cases of E. coli O157:H7 infection have occurred in the United States, Canada, Western Europe, Australia, Japan, Central and South America, the Middle and Far East, as well as Africa (Besser et al., 1999 , Peacock et al., 2001 ).
B. Transmission Information:
  1. From: Bos taurus To: Homo sapiens
    Mechanism: E. coli O157:H7 can be transmitted by food and water. Most cases are caused by ingestion of contaminated foods, particularly foods of bovine origin. In the United States, ingestion of undercooked hamburgers, prepared in a restaurant or in the home, has been a particularly important cause of outbreaks.The largest outbreak so far reported in North America involved hamburgers from a fast-food restaurant. Contamination of the hamburgers implicated in these outbreaks was the result in part of modern food-processing technology. Beef from thousands of cattle raised on hundreds of farms is ground together in a single hamburger plant, which then distributes frozen patties to thousands of restaurants in several states (Kudva et al., 1998 ).

C. Environmental Reservoir:
  1. Environmental Reservoir :
    1. Description: Many E. coli O157:H7 outbreaks have been traced to contaminated beef and dairy products (Boyce et al., 1995 ).
    2. Survival Information: E. coli O157:H7 may persist for long periods of time in manure (56-130 days) or even for 21 months. Survival by this microbe in soil was greatest (130 days) on soil cores containing rooted grass (Cornick et al., 2000 , Pell, 1997 , Gagliardi and Karns, 2000). The prevalence of E. coli O157:H7 increases during the summer and early fall months. Conversely, at other times of the year this microbe is present at very low levels, and in many cases its prevalence in cattle declines to zero during the winter months. Human outbreaks of E. coli O157:H7 have also shown seasonality. It was found that 88% of infections occurred in the months of summer and early autumn (Maule, 2000 ).
D. Intentional Releases:
  1. Intentional Release information :
    1. Description: E. coli infection.
    2. Emergency contact: If you believe that you have been exposed to a biological or chemical agent, or if you believe an intentional biological threat will occur or is occurring, contact your local health department and/or your local police or other law enforcement agency. The Centers for Disease Control and Prevention (CDC) Emergency Response Hotline (24 hours) 770-488-7100 (Website5, Website6).

III. Infected Hosts

  1. Humans and Cattle:
    1. Taxonomy Information:
      1. Species:
        1. Humans:
          • GenBank Taxonomy No.: 9606
          • Scientific Name: Homo sapiens (Website10)
          • Description: Direct links between E. coli O157:H7 in cattle and human infections have been confirmed by bacterial isolation and by the presence of serum antibodies against O157 and Shiga-toxin (Stx) antigens in dairy farm families and their cattle (Rasmussen and Casey, 2001 ).
        2. Cattle:
          • GenBank Taxonomy No.: 9913
          • Scientific Name: Bos taurus (Website9)
          • Description: Cattle are believed to be a major conduit for the passage of E. coli O157:H7 into the food supply, but other animals also shed this microorganism in their feces. Direct links between E. coli O157:H7 in cattle and human infections have been confirmed by bacterial isolation (Fegan and Desmarchelier, 1999, Fegan and Desmarchelier, 2002 ).

    2. Infection Process:
      1. Infectious Dose: One of the most important factors influencing E. coli O157:H7 infections is the low infectious dose, estimated at between 20 and 700 organisms in one study and less than 100 organisms in another (Tuttle et al., 1999 , Willshaw et al., 1994 ).
      2. Description: Infection by E. coli O157:H7 is most commonly caused by the consumption of undercooked, contaminated ground beef or beef products, also caused by contaminated drinking or recreational water, raw milk, and person to person contact (Beutin et al., 1993 , Oldfield, 2001 ). The infection mechanisms by which E. coli O157:H7 causes haemorrhagic colitis and HUS are not fully understood. E. coli O157:H7 is believed to adhere closely to mucosal cells of the large bowel, disrupting the brush border. This process alone may be sufficient to produce non-bloody diarrhoea. Shiga toxins have both local and systemic effects on the intestine and are probably critical to the development of bloody diarrhoea. Histopathological changes associated with infection include haemorrhage and oedema in the lamina propria with areas of superficial focal necrosis (Mead and Griffin, 1998 ). Beef products still account for most of the E. coli O157:H7 cases; however, other food like salad vegetables, fruits, alfalfa and radish sprouts, unpasteurized apple cider, mayonnaise, yogurt, and salami have also been implicated in recent major outbreaks (Beutin et al., 1993 , Oldfield, 2001 , Keene et al., 1994 ).

    3. Disease Information:
      1. E. coli O157:H7 infection/Diarrhea (Tuttle et al., 1999 , Willshaw et al., 1994 ):
        1. Pathogenesis Mechanism: Among the most important virulence characteristics of E. coli O157:H7 is its ability to produce one or more Shiga toxins (also called verocytotoxins, and formerly known as Shiga-like toxins). The first of these, Shiga toxin 1, is indistinguishable from Shiga toxin produced by Shigella dysenteriae type 1. The second, Shiga toxin 2, is a more divergent molecule, with only 56% amino acid homology with Shiga toxin 1. Most E. coli O157:H7 strains produce Shiga toxin 2; the percentage that also produce Shiga toxin 1 ranges from less than 25% in a series from Europe to greater than 80% in a series from North America (Slutsker et al., 1997 , Law and Kelly, 1995 , Mead and Griffin, 1998 ). Other factors thought to contribute to the virulence of E. coli O157:H7 include a virulence plasmid (pO157) and the locus of enterocyte effacement (LEE). The plasmid encodes a haemolysin that, in concert with specialised transport systems, may allow E. coli O157:H7 to use blood released into the intestine as a source of iron. The LEE contains genes for an adhesion molecule (intimin) and for other factors important to the production of attaching-effacing lesions (Law and Kelly, 1995 , Mead and Griffin, 1998 ). The mechanisms by which E. coli O157:H7 causes haemorrhagic colitis and haemolytic uraemic syndrome (HUS) are not fully understood. The organism is believed to adhere closely to mucosal cells of the large bowel, disrupting the brush border. This process alone may be sufficient to produce non-bloody diarrhoea. Shiga toxins have both local and systemic effects on the intestine and are probably critical to the development of bloody diarrhoea. Histopathological changes associated with infection include haemorrhage and oedema in the lamina propria with areas of superficial focal necrosis (Law and Kelly, 1995 , Moake, 1994 , Mead and Griffin, 1998 ). Damage of the endothelial cells, mediated by Shiga toxins, may trigger platelet and fibrin deposition, leading to injury of passing erythrocytes (haemolysis) and occlusion of renal microvasculature (renal failure). Thrombocytopenia is believed to reflect trapping of platelets in involved organs and removal by the liver and spleen. Inflammatory cytokines and circulating bacterial lipopolysaccharide may play an important part in augmenting this process. Although the kidneys are preferentially involved, other organs including the brain may be affected, resulting in a wide range of complications (Moake, 1994 , Thomas et al., 1996 , Mead and Griffin, 1998 ).


        2. Incubation Period: Incubation periods as short as 1 day and as long as 8 days (Riley et al., 1983).


        3. Prognosis: Most patients with haemorrhagic colitis recover spontaneously within 7 days (Riley et al., 1983).


        4. Symptom Information :
          • E. coli_O157H7 infection:
            • Description: The clinical manifestations of E. coli O157:H7 infection range from symptom-free carriage to non-bloody diarrhoea, haemorrhagic colitis, haemolytic uraemic syndrome, and death. The average interval between exposure and illness is 3 days. Illness typically begins with abdominal cramps and non-bloody diarrhoea. Bowel movements may become bloody over the next 1-2 days, with the amount of blood varying from a few small streaks to stools that are almost entirely blood. Over 70% of patients report bloody diarrhoea in most series, although lower frequencies have been reported in some outbreaks.Vomiting occurs in 30-60% of cases, and fever, usually low grade, can be documented in only 30%. The absence of fever may lead clinicians to favour non-infectious diagnoses, such as intussusception, ischaemic colitis, haemorrhage, or inflammatory bowel disease. Abdominal tenderness may be pronounced, prompting surgery for a presumed appendicitis (Riley et al., 1983, MacDonald et al., 1996 , Mead and Griffin, 1998 ). Initial laboratory studies are generally unrevealing. Serum-leucocyte counts are usually elevated, but faecal leucocyte counts are less than ten per high-powered field in most patients, even in the presence of bloody diarrhoea. Barium enema may demonstrate "thumb-printing", suggestive of oedema and submucosal haemorrhage, especially in the region of the ascending and transverse colon. When endoscopy is done, the colonic mucosa often appears oedematous and hyperaemic, sometimes with superficial ulcerations or pseudomembranes (Pickering et al., 1994 , Mead and Griffin, 1998 ). The percentage of cases that progress to haemolytic uraemic syndrome (HUS) ranged from 3-7% in series of sporadic cases to about 20% or more in some outbreaks. Haemolytic uraemic syndrome (HUS) is typically diagnosed 6 days after the onset of diarrhoea. Some patients have abnormal laboratory values, suggestive of an incomplete form of haemolytic uraemic syndrome (HUS). Among patients with haemolytic uraemic syndrome (HUS), about 3-5% die acutely and a similar percentage develop end-stage renal disease. Many patients who regain renal function have chronic proteinuria, and some develop end-stage renal disease years or even decades later. Other long-term sequelae include cholelithiasis, colonic stricture, chronic pancreatitis, glucose intolerance, and cognitive impairment (Carter et al., 1987 , Robson, 2000 , Mead and Griffin, 1998 ).

        5. Treatment Information:
          • Dialysis/Hemofiltration: There are retrospective studies which suggest that patients who received antibiotics may be at greater risk of developing haemolytic uraemic syndrome (HUS). Current treatment regimens may include dialysis, hemofiltration, transfusion of packed erythrocytes, platelet infusions, and other interventions as clinically indicated. Severe disease may require renal transplant (Siegler, 1995 , Robson, 2000 ).
            • Applicable: E. coli O157:H7 infection.
            • Drug Resistance: Most strains tested during the early and mid-1980s were susceptible to ampicillin, trimethoprim-sulfamethoxazole, tetracycline, and quinolones, and resistant to erythromycin, metronidazole, and vancomycin (Bopp et al., 1987 ). More recently, investigators have reported increasing rates of resistance to streptomycin, sulfisoxazole, and tetracycline, possibly as a result of the prevalence of this organism in food animals that receive these antibiotics (Kim et al., 1994 ).
          • Synsorb-Pk: A promising therapy now being evaluated in clinical trials is Synsorb-Pk, which consists of a chemically synthesized analog of Shiga toxin receptor Gb3 attached to chromosorb P (Synsorb Pk) as a specific absorbing agent of Shiga toxin 1 and 2. This compound would be ingested by patients with bloody diarrhea in the hope that it could absorb toxin from the intestine and prevent the development of haemolytic uraemic syndrome (HUS) (Takeda et al., 1999 ).
            • Applicable: E. coli O157:H7 infection.
          • Toxin-neutralising antibodies: Possible future treatments for E. coli O157:H7 infection include orally administered shiga toxin-binding resins and toxin-neutralising antibodies. Natural infection with E. coli O157:H7 does not confer immunity, and no human vaccine is currently available (Lissner et al., 1996 ).
            • Applicable: E. coli O157:H7 infection.

    4. Prevention:
      1. Consumer education:
        • Description: Consumers should be aware that microbiologic testing in meat processing plants cannot eliminate the risk for contamination of ground beef with E. coli O157:H7 and other pathogens. Consumers also can protect themselves by using safe food preparation practices. Frozen ground beef should be thawed in the refrigerator rather than at room temperature. Ground beef should be cooked thoroughly to internal temperatures of at least 160 degrees fahrenheit (71 degrees celcius). Using meat thermometers will help ensure that internal temperatures are high enough to kill bacteria. To reduce the risk for cross-contamination, consumers should use soap and hot water to wash hands, utensils, and other surfaces that might have come into contact with raw or undercooked ground beef and other meat products. Additional food safety and product recall information is available from USDA at http://www.usda.gov; telephone 866-849-7438 (CDC Report, 2002 ).

    5. Model System:

      No model system information is currently available here.


IV. Labwork Information

A. Biosafety Information:
  1. General biosafety information :
    • Biosafety Level: Biosafety Level 2.
    • Precautions:
      • Hemolytic uremic syndrome occurs in a small proportion of patients and is responsible for most deaths associated with infections with these organisms. Domestic farm animals (particularly bovines) are significant reservoirs of the organisms. However, experimentally infected small animals are also sources of infection in the laboratory. Laboratory Hazards: Enterohemorrhagic E. coli O157:H7 is usually isolated from feces. A variety of foods contaminated with the organisms may serve as vehicles of spread, and include uncooked ground beef and unpasteurized dairy products. It may rarely be found in blood of infected humans or animals. Ingestion is the primary laboratory hazard. The importance of aerosol exposure is not known. Recommended Precautions: Biosafety Level 2 practices, containment equipment, and facilities are recommended for all activities utilizing known or potentially infectious clinical materials or cultures. Animal Biosafety Level 2 facilities and practices are recommended for activities with experimentally or naturally infected animals. Vaccines are currently not available for use in humans. There have been at least three cases of laboratory-acquired infection with E. coli O157:H7 with serious consequences including renal failure and hemorrhagic colitis. No laboratory accident or obvious breach in technique was evident in any of these cases. This level of biohazard is due to the extremely low dose required for infection and the potent effects of shiga toxin (Stx), which are not limited to the intestine (Booth and Rowe, 1993, Rao et al., 1996 , Website4).
B. Culturing Information:
  1. E. coli Culturing Method :
    1. Description: The agar medium most commonly used for the isolation of E. coli O157:H7 is MacConkey agar containing sorbitol (SMAC agar), which is available from multiple commercial sources. This medium contains 1% sorbitol in place of lactose in the standard MacConkey medium. Sorbitol-MacConkey agar plates are inoculated with the fecal specimen and examined after 18 to 24 h of incubation at 37 degrees celcius for the presence of colorless, sorbitol-negative colonies. Multiple sorbitol-nonfermenting colonies (at least 3 and up to 10) should be selected for testing as potential E. coli O157:H7 (March and Ratnam., 1986, Gunzer et al., 1992 ).

    2. Medium:
      1. MacConkey agar containing sorbitol (SMAC agar). This medium contains 1% sorbitol in place of lactose in the standard MacConkey medium (March and Ratnam., 1986).
    3. Optimal Temperature: 37 degrees celcius (March and Ratnam., 1986).
C. Diagnostic Tests :
  1. Organism Detection Tests:
    1. Gram Staining:
      1. Time to Perform: minutes-to-1-hour
      2. Description: Gram-staining is a four part procedure which uses certain dyes to make a bacterial cell stand out against its background. The specimen should be mounted and heat fixed on a slide before you procede to stain it (Website7, Website8).
      3. False Positive: Not using enough decolorizer may yield a false Gram (+) results (Website7).
      4. False Negative: Using too much decolorizer could result in a false Gram (-) result (Website7).

  2. Immunoassay Tests:
    1. Commercial Latex Agglutination Kits:
      1. Time to Perform: 1-to-2-days
      2. Description: The Centers for Disease Control and Prevention (CDC) has evaluated three commercial latex reagent kits for detecting the O157 antigen (Oxoid Diagnostic Reagents, Hampshire, England: http://www.oxoid.com; Pro-Lab Inc., Richmond Hill, Ontario, Canada: http://www.prolabinc.com/; and Remel Microbiology Products, Lenexa, Kansas: http://www.remelinc.com) and one latex reagent kit for detecting the H7 antigen (Remel). The results of this study showed 100% correlation of the commercial O157 kits with the CDC reference antisera. Many strains that gave initial negative reactions with the H7 reagent became positive when passed through motility medium to enhance motility. The CDC study concluded that the commercial latex reagents are good alternatives to standard serologic methods for identifying the E. coli O157 and H7 antigens when the manufacturer directions are closely followed (Fields et al., 1997 , Sowers et al., 1996 ).
      3. False Positive: Some false-positive reactions with both the commercial and CDC sera were seen with a strain of Citrobacter freundii and strains of Salmonella O group N. The O157 antigen was previously shown to be identical to the Salmonella O301 antigen (Sowers et al., 1996 ).
      4. False Negative: For 106 strains of E. coli and related organisms that were not enhanced for motility through semisolid medium, the Remel H7 latex reagent had a sensitivity of 96% (Sowers et al., 1996 ).
    2. Assurance EHEC EIA:
      1. Time to Perform: 1-to-2-days
      2. Description: Some kits are available for accuracy detection of O157:H7 in food and environmental samples. Minimal labor for preparation. Assurance EIAs (Assurance EHEC EIA, BioControl Systems, Inc.) are used extensively in industry, independent and government laboratories. E. coli 0157 Immunocapture - a rapid and convenient method which can be used to facilitate and enhance the isolation of E. coli 0157:H7 from enrichment cultures (TECRA, Inc.). Additional information: http://www.rapidmethods.com/products/assehec.html, http://www.tecra.net (Website2, Website3).

  3. Nucleic Acid Detection Tests: :
    1. PCR Detection of Shiga Toxins Genes:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: Detection of shiga toxins (stx) genes: The PCR technique has been extensively used to detect stx genes either in stx-only techniques or in multiplex PCR techniques incorporating primers for eae, or fliC. Numerous primers and PCR protocols have been designed to amplify these genes. Some early studies used a single primer pair to detect both stx1 and stx2, but most methods now include two primer pairs that yield different-sized products for stx1 and stx2. Predicted sizes of amplified products: VT1- 732, VT2-779, EAE-890, EAE157-1,087, FLIC-1,771, FLICH7-625 bp (Gannon et al., 1997 ). Predicted sizes of amplified products: SLT I-348, SLT II-584 bp (Cebula et al., 1995 ).
      3. Primers:
        • VT1
          • Forward: CATTGTCTGGTGACAGTAGCT
          • Reverse: CCCGTAATTTGCGCACTGAG
          • Product
            • Size: VT1: 732 bp
        • VT2
          • Forward: CCATGACAACGGACAGCAGTT
          • Reverse: CCTGTCAACTGAGCACTTTG
          • Product
            • Size: VT2: 779 bp
        • EAE
          • Forward: GTGGCGAATACTGGCGAGACT
          • Reverse: CCCCATTCTTTTTCACCGTCG
          • Product
            • Size: EAE: 890 bp
        • EAE157
          • Forward: CAGGTCGTCGTGTCTGCTAAA
          • Reverse: TCAGCGTGGTTGGATCAACCT
          • Product
            • Size: EAE157: 1,087 bp
        • FLIC
          • Forward: CCGAATTCATGGCACAAGTCATTAATAC
          • Reverse: CCGAATTCTTAACCCTGCAGTAGAGACA
          • Product
            • Size: FLIC: 1,771 bp
        • FLICH7
          • Forward: GCGCTGTCGAGTTCTATCGAGC
          • Reverse: CAACGGTGACTTTATCGCCATTCC
          • Product
            • Size: FLICH7: 625 bp
        • LP30/31
          • Forward: CAGTTAATGTGGTGGCGAAGG
          • Reverse: CACCAGACAATGTAACCGCTG
          • Product
            • Size: SLT I: 348 bp
        • LP43/44
          • Forward: ATCCTATTCCCGGGAGTTTACG
          • Reverse: GCGTCATCGTATACACAGGAGC
          • Product
            • Size: SLT II: 584 bp
    2. PCR for stx1, stx2, eaeA, and hlyA Genes:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: PCR is generally considered to be the most sensitive means of determining whether a fecal specimen or a food sample contains E. coli O157:H7. PCR has also been used for the detection and genetic characterization of E. coli O157:H7 in cultures of feces or foodstuffs. This assay utilizes four PCR primer pairs and detects the presence of stx1, stx2, eaeA, and hlyA, generating amplification products of 180, 255, 384, and 534 bp, respectively (Paton and Paton, 1998 , Paton and Paton, 2002 ).
      3. Primers:
        • stx1
          • Forward: ATAAATCGCCATTCGTTGACTAC
          • Reverse: AGAACGCCCACTGAGATCATC
          • Product
            • Size: stx1: 180 bp
        • stx2
          • Forward: GGCACTGTCTGAAACTGCTCC
          • Reverse: TCGCCAGTTATCTGACATTCTG
          • Product
            • Size: stx2: 255 bp
        • eaeA
          • Forward: GACCCGGCACAAGCATAAGC
          • Reverse: CCACCTGCAGCAACAAGAGG
          • Product
            • Size: eaeA: 384 bp
        • hlyA
          • Forward: GCATCATCAAGCGTACGTTCC
          • Reverse: AATGAGCCAAGCTGGTTAAGCT
          • Product
            • Size: hlyA: 534 bp
    3. PCR for Hemolysin Gene:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: A 3.4-kb fragment probe empirically derived from the large plasmid of enterohemorrhagic Escherichia coli O157:H7 strain EDL 933 has been extensively used to identify and characterize EHEC strains despite the unknown function of the sequences contained on this fragment. This fragment was subsequently shown to contain the ehxA (hlyA) genes encoding the EHEC hemolysin (Schmidt et al., 1995 , Meng et al., 1998 ).
      3. Primers:
        • hlyA
          • Forward: GGTGCAGCAGAAAAAGTTGTA
          • Reverse: TCTCGCCTGATAGTGTTTGGTA
          • Product
            • Size: 1,551 bp
        • another pair for hlyA
          • Forward: AGCCGGAACAGTTCTCTCAG
          • Reverse: CCAGCATAACAGCCGATGT
          • Product
            • Size: 526 bp

  4. Other Types of Diagnostic Tests:

    No other tests available here.


V. References

A. Journal References:
Besser et al., 1999 : Besser R E, Griffin P M, Slutsker L. Escherichia coli O157:H7 gastroenteritis and the hemolytic uremic syndrome: an emerging infectious disease. Annual Review of Medicine . 1999; 50: 355 - 367. [PubMed: 10073283].
Beutin et al., 1993 : Beutin L D, Geier H, Steinruck S, Zimmermann S, Scheutz F. Prevalence and some properties of verotoxin (Shiga-like toxin)-producing Escherichia coli in seven different species of healthy domestic animals. Journal of Clinical Microbiology. 1993; 31(9): 2483 - 2488. [PubMed: 8408571].
Booth and Rowe, 1993: Booth L, Rowe B. Possible occupational acquisition of Escherichia coli O157 infection. Lancet. 1993; 342(8882): 1298 - 1299. [PubMed: 7901599].
Bopp et al., 1987 : Bopp C A, Greene K D, Downes F P, Sowers EG, Wells JG, Wachsmuth IK. Unusual verotoxin-producing Escherichia coli O157:H7 associated with hemorrhagic colitis. Journal of Clinical Microbiology. 1987; 25(8): 1486 - 1489. [PubMed: 3305564].
Boyce et al., 1995 : Boyce TG, Swerdlow D L, Griffin P M. Escherichia coli O157:H7 and the hemolytic-uremic syndrome. New England Journal of Medicine. 1995; 333(6): 364 - 368. [PubMed: 7609755].
Burland et al., 1998 : Burland V, Shao Y, Perna N T, Plunkett G, Sofia HJ, Blattner FR. The complete DNA sequence and analysis of the large virulence plasmid of Escherichia coli O157:H7. Nucleic Acids Research. 1998; 26(18): 4196 - 4204. [PubMed: 9722640].
Carter et al., 1987 : Carter A O, Borczyk A A, Carlson J A, Harvey B, Hockin JC, Karmali MA, Krishnan C, Korn DA, Lior H. A severe outbreak of Escherichia coli O157:H7-associated hemorrhagic colitis in a nursing home. New England Journal of Medicine. 1987; 317(24): 1496 - 1500. [PubMed: 3317047].
CDC Report, 2002 : CDC Report. From the Centers for Disease Control and Prevention. Multistate outbreak of Escherichia coli O157:H7 infections associated with eating ground beef-United States, June-July 2002. JAMA. 2002; 288(6): 690 - 691. [PubMed: 12182163].
Cebula et al., 1995 : Cebula TA, Payne W L, Feng P. Simultaneous identification of strains of Escherichia coli serotype O157:H7 and their Shiga-like toxin type by mismatch amplification mutation assay-multiplex PCR. Journal of Clinical Microbiology. 1995; 33(1): 248 - 250. [PubMed: 7535315].
Cornick et al., 2000 : Cornick N A, Booher S L, Casey TA, Moon H W. Persistent colonizationof sheep by Escherichia coli O157:H7 and other E. coli pathotypes. Applied and Environmental Microbiology. 2000; 66(11): 4926 - 4934. [PubMed: 11055945].
Donnenberg and Whittam, 2001 : Donnenberg M S, Whittam T S. Pathogenesis and evolution of virulence in enteropathogenic and enterohemorrhagic Escherichia coli. Journal of Clinical Investigation. 2001; 107(5): 539 - 548. [PubMed: 11238553].
Doyle and Schoeni, 1984: Doyle M P, Schoeni J L. Survival and growth characteristics of Escherichia coli O157:H7 associated with hemorrhagic colitis. Applied and Environmental Microbiology. 1984; 48(4): 855 - 856. [PubMed: 6391379].
Fegan and Desmarchelier, 1999: Fegan N, Desmarchelier P. Shiga toxin-producing Escherichia coli in sheep and preslaughter lambs in eastern Australia. Letters in Applied Microbiology. 1999; 28(5): 335 - 339. [PubMed: 10347885].
Fegan and Desmarchelier, 2002 : Fegan N, Desmarchelier P. Comparison between human and animal isolates of Shiga toxin-producing Escherichia coli O157 from Australia. Epidemiology and Infection. 2002; 128(3): 357 - 362. [PubMed: 12113478].
Fields et al., 1997 : Fields P I, Blom K, Hughes H J, Helsel LO, Feng P, Swaminathan B. Molecular characterization of the gene encoding H antigen in Escherichia coli and development of a PCR-restriction fragment length polymorphism test for identification of E. coli O157:H7 and O157:NM. Journal of Clinical Microbiology. 1997; 35(5): 1066 - 1070. [PubMed: 9114382].
Gagliardi and Karns, 2000: Gagliardi J V, Karns J S. Leaching of Escherichia coli O157:H7 in diverse soils under various agricultural management practices. Applied and Environmental Microbiology. 2000; 66(3): 877 - 883. [PubMed: 10698745].
Gannon et al., 1997 : Gannon V P, D'Souza S, Graham T, King RK, Rahn K, Read S. Use of the flagellar H7 gene as a target in multiplex PCR assays and improved specificity in identification of enterohemorrhagic Escherichia coli strains. Journal of Clinical Microbiology. 1997; 35(3): 656 - 662. [PubMed: 9041407].
Gunzer et al., 1992 : Gunzer F, Bohm H, Russmann H, Bitzan M, Aleksic S, Karch H. Molecular detection of sorbitol-fermenting Escherichia coli O157 in patients with hemolytic-uremic syndrome. Journal of Clinical Microbiology. 1992; 30(7): 1807 - 1810. [PubMed: 1629338].
Hayashi et al., 2001 : Hayashi T, Makino K, Ohnishi M, Kurokawa K, Ishii K, Yokoyama K, Han CG, Ohtsubo E, Nakayama K, Murata T, Tanaka M, Tobe T, Iida T, Takami H, Honda T, Sasakawa C, Ogasawara N, Yasunaga T, Kuhara S, Shiba T, Hattori M, Shinagawa H. Complete Genome Sequence of Enterohemorrhagic Escherichia coli O157:H7 and Genomic Comparison with a Laboratory Strain K-12. DNA Research. 2001; 8(1): 11 - 22. [PubMed: 11258796].
Hayes et al., 1995: Hayes P S, Blom K, Feng P, Lewis J, Strockbine NA, Swaminathan B. Isolation and characterization of a glucuronidase-producing strain of Escherichia coli serotype O157:H7 in the United States. Journal of Clinical Microbiology. 1995; 33(12): 3347- - 3348. [PubMed: 8586736].
Karmali et al., 1983 : Karmali M A, Steele B T, Petric M, Lim C. Sporadic cases of haemolytic uremic syndrome associated with faecal cytotoxin and cytotoxin-producing Escherichia coli in stools. Lancet. 1983; 1(8325): 619 - 620. [PubMed: 6131302].
Keene et al., 1994 : Keene W E, McAnulty J M, Hoesly F C, Williams LP Jr, Hedberg K, Oxman GL, Barrett TJ, Pfaller MA, Fleming DW. A swimming-associated outbreak of hemorrhagic colitis caused by Escherichia coli O157:H7 and Shigella sonnei. New England Journal of Medicine. 1994; 331(9): 579 - 584. [PubMed: 8047082].
Kim et al., 1994 : Kim H H, Samadpour M, Grimm L, Clausen CR, Besser TE, Baylor M, Kobayashi JM, Neill MA, Schoenknecht FD, Tarr PI. Characteristics of antibiotic-resistant Escherichia coli O157:H7 in Washington state, 1984-91. Journal of Infectious Diseases. 1994; 1701(6): 606 - 609. [PubMed: 7996005].
Kudva et al., 1998 : Kudva I T, Blanch K, Hovde C J. Analysis of Escherichia coli O157:H7 survival in ovine or bovine manure and manure slurry. Applied and Environmental Microbiology. 1998; 64(9): 3166 - 3174. [PubMed: 9726855].
Law and Kelly, 1995 : Law D, Kelly J. Use of heme and hemoglobin by Escherichia coli O157 and other Shiga-like-toxin-producing E. coli serogroups. Infection and Immunity. 1995; 63(2): 700 - 702. [PubMed: 7822044].
Lissner et al., 1996 : Lissner R, Schmidit H, Karch H. A standard immunoglobulin preparation produced from bovine colostra shows antibody reactivity and neutralization activity against Shiga-like toxins and EHEC-hemolysin of Escherichia coli O157:H7. Infection. 1996; 24(5): 378 - 383. [PubMed: 8923050].
MacDonald et al., 1996 : MacDonald I A, Gould IM, Curnow J. Epidemiology of infection due to Escherichia coli O157: a 3-year prospective study. Epidemiology and Infection. 1996; 116(3): 279 - 284. [PubMed: 8666071].
Makino et al., 1998 : Makino K, Ishii K, Yasunaga T, Hattori M, Yokoyama K, Yutsudo CH, Kubota Y, Yamaichi Y, Iida T, Yamamoto K, Honda T, Han CG, Ohtsubo E, Kasamatsu M, Hayashi T, Kuhara S, Shinagawa H Complete nucleotide sequences of 93-kb and 3.3-kb plasmids of an enterohemorrhagic Escherichia coli O157:H7 derived from Sakai outbreak . DNA Research. 1998; 5(1): 1 - 9. [PubMed: 9628576].
March and Ratnam., 1986: March S. B., Ratnam S. Sorbitol-MacConkey medium for detection of Escherichia coli O157:H7 associated with hemorrhagic colitis. Journal of Clinical Microbiology. 1986; 23(5): 869 - 872. [PubMed: 3519658].
Maule, 2000 : Maule A. Survival of verocytotoxigenic Escherichia coli O157 in soil, water and on surfaces. Symp Ser Soc Appl Microbiol. 2000; 29: 71S - 78S. [PubMed: 10880181].
Mead and Griffin, 1998 : Mead P S, Griffin PM. Escherichia coli O157:H7. Lancet. 1998; 352(9135): 1207 - 1212. [PubMed: 9777854].
Meng et al., 1998 : Meng J, Zhao S, Doyle M P. Virulence genes of Shiga toxin-producing Escherichia coli isolated from food, animals and humans. International Journal of Food Microbiology. 1998; 45(3): 229 - 235. [PubMed: 9927001].
Moake, 1994 : Moake J L. Haemolytic-uraemic syndrome: basis science. Lancet. 1994; 343(8894): 393 - 397. [PubMed: 7905556].
Oldfield, 2001 : Oldfield E C. Emerging foodborne pathogens: keeping your patients and your families safe. Reviews in Gastroenterological Disorders. 2001; 1(4): 177 - 186. [PubMed: 12120184].
Paton and Paton, 1998 : Paton A W, Paton J C. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. Journal of Clinical Microbiology. 1998; 36(2): 598 - 602. [PubMed: 9466788].
Paton and Paton, 2002 : Paton A W, Paton J C. Direct detection and characterization of Shiga toxigenic Escherichia coli by multiplex PCR for stx1, stx2, eae, ehxA, and saa. Journal of Clinical Microbiology. 2002; 40(1): 271 - 274. [PubMed: 11773130].
Peacock et al., 2001 : Peacock E, Jacob V W, Fallone S M. Escherichia coli O157:H7: etiology, clinical features, complications, and treatment. Nephrology Nursing Journal . 2001; 28(5): 547 - 555. [PubMed: 12143430].
Pell, 1997 : Pell A N. Manure and microbes: public and animal health problem? . Journal of Dairy Science. 1997; 80(10): 73 - 81. [PubMed: 9361239].
Perna et al., 2001 : Perna N T, Plunkett G, Burland V, Mau B, Glasner JD, Rose DJ, Mayhew GF, Evans PS, Gregor J, Kirkpatrick HA, Posfai G, Hackett J, Klink S, Boutin A, Shao Y, Miller L, Grotbeck EJ, Davis NW, Lim A, Dimalanta ET, Potamousis KD, Apodaca J, Anantharaman TS, Lin J, Yen G, Schwartz DC, Welch RA, Blattner FR. Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature. 2001; 409(6819): 529 - 533. [PubMed: 11206551].
Pickering et al., 1994 : Pickering L K, Obrig T G, Stapleton F B. Hemolytic-uremic syndrome and enterohemorrhagic Escherichia coli. Pediatric Infectious Disease Journal. 1994; 13(6): 459 - 475. [PubMed: 8078733].
Rao et al., 1996 : Rao G G, Saunders B P, Masterton R G. Laboratory acquired verotoxin producing Escherichia coli (VTEC) infection. Journal of Hospital Infection. 1996; 33(3): 228 - 230. [PubMed: 8827511].
Rasmussen and Casey, 2001 : Rasmussen M A, Casey TA. Environmental and food safety aspects of Escherichia coli O157: H7 infections in cattle. Critical Reviews in Microbiology.. 2001; 27(2): 57 - 73. [PubMed: 11450854].
Riley et al., 1983: Riley L W, Remis R S, Helgerson S D, McGee HB, Wells JG, Davis BR, Hebert RJ, Olcott ES, Johnson LM, Hargrett NT, Blake PA, Cohen ML. Hemorrhagic colitis associated with a rare Escherichia coli serotype. New England Journal of Medicine. . 1983; 308(12): 681 - 685. [PubMed: 6338386].
Robson, 2000 : Robson W L. Haemolytic uraemic syndrome. Pediatric Drugs. 2000; 2(4): 243 - 252. [PubMed: 10946413].
Schmidt et al., 1995 : Schmidt H, Beutin L, Karch H. Molecular analysis of the plasmid-encoded hemolysin of Escherichia coli O157:H7 strain EDL 933. Infection and Immunity. 1995; 6(3): 1055 - 1061. [PubMed: 7868227].
Siegler, 1995 : Siegler R L. The hemolytic uremic syndrome. Pediatric Clinics of North America. 1995; 42(6): 1505 - 1529. [PubMed: 8614598].
Slutsker et al., 1997 : Slutsker L, Ries A A, Greene K D, Wells JG, Hutwagner L, Griffin PM. Escherichia coli O157:H7 diarrhea in the United States: clinical and epidemiologic features. Annals of Internal Medicine. 1997; 126(7): 505 - 513. [PubMed: 9092315].
Sowers et al., 1996 : Sowers E G, Wells J G, Strockbine N A. Evaluation of commercial latex reagents for identification of O157 and H7 antigens of Escherichia coli. Journal of Clinical Microbiology. 1996; 34(5): 1286 - 1289. [PubMed: 8727921].
Takeda et al., 1999 : Takeda T, Yoshino K, Adachi E, Sato Y, Yamagata K. In vitro assessment of a chemically synthesized Shiga toxin receptor analog attached to chromosorb P (Synsorb Pk) as a specific absorbing agent of Shiga toxin 1 and 2. Microbiology and Immunology. 1999; 43(4): 331 - 337. [PubMed: 10385199].
Thomas et al., 1996 : Thomas A, Cheasty T, Frost J A, Chart H, Smith HR, Rowe B. Vero cytotoxin-producing Escherichia coli, particularly serogroup O157, associated with human infections in England and Wales: 1992-4. Epidemiology and Infection. 1996; 117(1): 1 - 10. [PubMed: 8760944].
Tuttle et al., 1999 : Tuttle J, Gomez T, Doyle M P, Wells JG, Zhao T, Tauxe RV, Griffin PM. Lessons from a large outbreak of Escherichia coli O157:H7 infections: insights into the infectious dose and method of widespread contamination of hamburger patties. Epidemiology and Infection . 1999; 122(2): 185 - 192. [PubMed: 10355781].
Willshaw et al., 1994 : Willshaw G, Thirwell J, Jones A, Parry S, Salmon RL, Hickey M. Vero cytotoxin-producing Escherichia coli O157 in beefburgers linked to an outbreak of diarrhoea, haemorrhagic colitis and haemolytic uraemic syndrome in Britain. Letters in Applied Microbiology. 1994; 19(5): 304 - 307. [PubMed: 7765442].
B. Book References:

No book references used.

C. Website References:
Website1: NCBI. Taxonomy. Escherichia coli O157:H7. [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=83334 ].
Website2: Assurance EIA EHEC. [ http://www.rapidmethods.com/products/assehec.html ].
Website3: E. coli 0157 Immunocapture (Click on Products-E. coli 0157). [ http://www.tecra.net ].
Website4: CDC. Agent summary statements section VII-A: Bacterial agents. [ http://www.cdc.gov/od/ohs/biosfty/bmbl4/bmbl4s7a.htm ].
Website5: CDC. What to do in an emergency. [ http://www.bt.cdc.gov/EmContact/index.asp ].
Website6: CDC. Information networks and other information sources. [ http://www.cdc.gov/other.htm#states ].
Website7: Gram-staining procedure. [ http://medic.med.uth.tmc.edu/path/00001445.htm ].
Website8: FDA. Microscopic examination of foods. [ http://www.cfsan.fda.gov/~ebam/bam-2.html ].
Website9: NCBI. Bos taurus. [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9913 ].
Website10: NCBI. Homo sapiens. [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9606 ].
Website11: NCBI. Escherichia coli O157:H7 EDL933. [ http://www.ncbi.nlm.nih.gov/genomes/framik.cgi?db=genome&gi=169 ].
Website12: NCBI. Genome. Escherichia coli O157:H7. [ http://www.ncbi.nlm.nih.gov/genomes/framik.cgi?db=genome&gi=176 ].
Website13: NCBI. Escherichia coli plasmid pO157. [ http://www.ncbi.nlm.nih.gov/genomes/framik.cgi?db=genome&gi=15229 ].
Website14: NCBI. Escherichia coli plasmid pOSAK1. [ http://www.ncbi.nlm.nih.gov/genomes/framik.cgi?db=genome&gi=15228 ].
Website15: Escherichia coli picture. [ http://www.med.sc.edu:85/fox/e_coli-dk.jpg ].
Website 68: Dennis Kunkel Microscopy, Inc. [ http://www.denniskunkel.com/ ].
D. Thesis References:

No thesis or dissertation references used.


VI. Curation Information