Variola Virus
I. Organism Information
A. Taxonomy Information
-
Species:
-
Variola virus
(Website 4):
-
GenBank Taxonomy No.:
10255
-
Description:
The poxviruses (of the family Poxviridae) are a family of large, enveloped deoxyribonucleic acid (DNA) viruses. The most notorious poxvirus is variola, the causative agent of smallpox. Smallpox was an important cause of morbidity and mortality in the developing world until recent times. Since the host range of the variola virus is confined to humans, aggressive case identification and contact vaccination were ultimately successful in controlling the disease. The last occurrence of endemic smallpox was in Somalia in 1977, and the last human cases were laboratory-acquired infections in 1978. By 1980, the World Health Organization (WHO) General Assembly ratified the declaration of success made by the Global Commission for the Certification of Smallpox Eradication (Website 1).
-
Variant(s):
-
Variola major virus
(Website 5):
-
GenBank Taxonomy No.:
12870
-
Parent:
Variola major virus
-
Description:
Variola major is the severe and most common form of smallpox, with a more extensive rash and high fever. There are four types of variola major smallpox: ordinary (the most frequent type, accounting for 90% or more of cases); modified (mild and occurring in previously vaccinated persons); flat; and hemorrhagic (both rare and very severe). Historically, variola major has an overall fatality rate of about 30%; however, flat and hemorrhagic smallpox usually are fatal (Website 13).
-
Variola minor
(Website 6, Website 2):
-
GenBank Taxonomy No.:
52358
-
Parent:
Variola major virus
-
Description:
In 1904 Korte described a very mild smallpox-like disease with a case-fatality rate of 1% or less in unvaccinated persons that had occurred in South Africa for several years and was known locally as kaffir-pox, or "amaas" (Fenner et al., 1988).
Subsequently, Chapin recognized that a similar mild disease had been occurring in North America since about 1896, and had subsequently been exported from there to South America, Europe, and Australia (Fenner et al., 1988).
Virological studies showed that there was no doubt that 'amass' and 'alastrim' as it is called in South America were indeed mild varieties of smallpox. Although many other names were used, this clinico-epidemiological variety of smallpox has come to be called variola minor, a designation that led to the use of the term variola major for classical smallpox (Fenner et al., 1988).
B. Lifecycle Information
(Henderson et al., 1999):
-
Virion
(Henderson et al., 1999):
-
Size:
The virus particles are brick-shaped to ovoid and measure approximately 300 by 200 by 100 um (Klietmann and Ruoff, 2001).
-
Shape:
The virus particles are brick-shaped to ovoid and measure approximately 300 by 200 by 100 um (Klietmann and Ruoff, 2001).
-
Picture(s):
-
Smallpox virus by negative stain electron microscopy (Website 15):
Description: Smallpox virus, single virion, as seen by negative stain electron microscopy. The brick-shaped virion is covered with what looks like filaments (although in reality this outer layer is not really like a ball of string). This virion is from a human skin lesion, from a diagnostic specimen that came to the Centers for Disease Control in 1966 as part of the WHO Global Smallpox Eradication Program. Magnification about x150,000. Micrograph from F. A. Murphy, School of Veterinary Medicine, University of California, Davis.
-
Other:
- Kaffir-pox
Korte (1904) described a very mild pox-like disease that had occurred in South Africa for several years and was known locally as kaffir-pox, or "amaas" (Fenner et al., 1988B).
- Amaas
Korte (1904) described a very mild pox-like disease that had occurred in South Africa for several years and was known locally as kaffir-pox, or "amaas" (Fenner et al., 1988B).
C. Genome Summary:
-
Genome of
Variola virus
-
Description:
VAR strain India-1967 was isolated from a patient in India in 1967. The strain had undergone 5 passages on chorioallantoic membranes of chick embryos and is maintained in the collection of WHO Collaborating Center on Smallpox and Related Infections, Institute for Viral Preparations, Moscow, Russian Federation (Shchelkunov et al., 1993).
-
Variola virus Genome Information (Website 7, Website 11):
-
GenBank Accession Number:
NC_001611, X69198
-
Size:
185578 bp (Website 7, Website 11)
-
Gene Count:
There are 187 putative proteins identified from the sequencing of variola virus (Website 1).
-
Description:
Possessing one of the largest genomes of any virus, an Orthopoxvirus consists of one piece of double-stranded DNA, which is cross-linked at each end. With their brick-shaped morphology, poxviruses have a biconcave core containing the DNA genome. The virus-encoded enzymes in the core are critical to transcription of the viral DNA. Genes encoding the nonessential functions important for virus virulence are arrayed near the ends of the genome; as would be expected, the greatest heterogeneity between poxviruses is at these genomic ends (Website 1).
-
Genome of
Variola major virus
(Massung et al., 1994):
-
Description:
This virus strain was isolated from scab material from the last naturally occurring case of variola major in the world, which occurred in a 3-year-old girl who survived ordinary smallpox diagnosed on October 16, 1975, in Kuralia, South Dingaldi, Bhola Island, Bangladesh (Massung et al., 1994).
-
Variola major virus Bangladesh-1975 Genome Information (Website 8):
-
GenBank Accession Number:
L22579
-
Size:
186103 bp (Website 8)
-
Gene Count:
187 (Massung et al., 1994)
-
Description:
Massung et al. (1994) analyzed the 186,102 base pairs (bp) that constitute the entire DNA genome of a highly virulent variola virus isolated from Bangladesh in 1975. They found that the linear, double-stranded molecule has relatively small (725 bp) inverted terminal repeat (ITR) sequences containing three 69-bp direct repeat elements, a 54-bp partial repeat element, and a 105-base telomeric end-loop that can be maximally base-paired to contain 17 mismatches. Proximal to the right-end ITR sequences are another seven 69-bp elements and a 53- and a 27-bp partial element. Sequence analysis showed 187 closely spaced open reading frames specifying putative major proteins containing greater than or equal to 65 amino acids. Most of the virus proteins correspond to proteins in current databases, including 150 proteins that have greater than 90% identity to major gene products encoded by vaccinia virus, the smallpox vaccine. Variola virus has a group of proteins that are truncated compared with vaccinia virus counterparts and a smaller group of proteins that are elongated. The terminal regions encode several novel proteins and variants of other poxvirus proteins that potentially augment variola virus transmissibility and virulence for its only natural host, humans (Massung et al., 1994).
-
Genome of
Variola minor
(Shchelkunov et al., 2000):
-
Description:
This virus strain (Variola minor Garcia-1966) was isolated from skin lesions on a patient in Sao Paulo during an alastrim outbreak in Brazil in 1966 that was associated with a 0.8% case fatality rate. The isolate has been used as a diagnostic reference strain at the Adolpho Lutz Institute, Sao Paulo, and was provided to CDC in the late 1960's. It was also used as a reference strain at CDC (Shchelkunov et al., 2000).
-
Variola minor Garcia-1966 Genome Information (Website 9, Website 10):
-
GenBank Accession Number:
X72086, Y16780
-
Size:
186986 bp (Shchelkunov et al., 2000)
-
Gene Count:
By computer analysis, Shchelkunov et al. (2000) identified 206 non-overlapping potential open reading frames containing greater than or equal to 60 amino acids (Shchelkunov et al., 2000).
-
Description:
Shchelkunov et al. (2000) analyzed the alastrim variola minor virus, which causes mild smallpox, and was first recognized in Florida and South America in the late 19th century. Genome linear double-stranded DNA sequences (186,986 bp) of the alastrim virus Garcia-1966, a laboratory reference strain from an outbreak associated with 0.8% case fatalities in Brazil in 1966, were determined except for a 530-bp fragment of hairpin-loop sequences at each terminus. The DNA sequences showed 206 potential open reading frames for proteins containing greater than or equal to 60 amino acids. The amino acid sequences of the putative proteins were compared with those reported for vaccinia virus strain Copenhagen and the Asian variola major strains India-1967 and Bangladesh-1975. About one-third of the alastrim viral proteins were 100% identical to correlates in the variola major strains and the remainder were greater than or equal to 95% identical. Compared with variola major virus DNA, alastrim virus DNA has additional segments of 898 and 627 bp, respectively, within the left and right terminal regions. The former segment aligns well with sequences in other orthopoxviruses, particularly cowpox and vaccinia viruses, and the latter is apparently alastrim-specific (Shchelkunov et al., 2000).
II. Epidemiology Information
A. Outbreak Locations:
-
By the time vaccination was introduced at the end of the 18th century, the distribution of smallpox was world-wide. It was endemic everywhere, except in remote areas with sparse populations, such as Australia, New Zealand and the islands of the Pacific, Atlantic, and Indian Oceans (Fenner et al., 1988C).
In 1959, the Twelfth World Health Assembly adopted a resolution introduced by the USSR calling for the world-wide eradication of smallpox (Fenner et al., 1988C).
By 1976 the only remaining endemic country was Ethiopia, in which variola minor persisted and spread to Somalia (Fenner et al., 1988C).
On October 26, 1977, the last case of naturally acquired smallpox occurred in the Merca District of Somalia. In May 1980, the World Health Assembly certified the world free of naturally occurring smallpox (MMWR, 2002).
B. Transmission Information:
-
From:
Homo sapiens
To:
Homo sapiens
,
With Destination:
Homo sapiens
(Fenner et al., 1988C):
Mechanism:
Smallpox is a viral disease unique to humans. To sustain itself, the virus must pass from person to person in a continuing chain of infection and is spread by inhalation of air droplets or aerosols (Henderson, 1999).
There are three principal routes of viral infection corresponding to the three principal surfaces of the body: the respiratory tract, the alimentary tract, and the skin. Minor routes of infection include the urinary and genital tracts and the conjunctiva. Although congenital infection occasionally occurred in smallpox, it was of no epidemiological importance (Fenner et al., 1988C).
C. Environment:
No environment information is currently available here.
D. Intentional Releases:
-
Intentional Release information
:
-
Description:
Smallpox probably was first used as a biological weapon during the French and Indian Wars (1754-1767) by British forces in North America. Soldiers distributed blankets that had been used by smallpox patients with the intent of initiating outbreaks among American Indians. Epidemics occurred, killing more than 50% of many affected tribes (Henderson et al., 1999).
-
Emergency contact:
If you believe that you have been exposed to a biological or chemical agent, or if you believe an intentional biological threat will occur or is occurring, please contact your local health department and/or your local police or other law enforcement agency (Website 12).
A possible case of smallpox is a public health emergency and of utmost international concern. State health officials should be contacted immediately, and the diagnosis confirmed in a Biological Safety Level 4 laboratory where staff members have been vaccinated. The state officials should contact the CDC (Centers for Disease Control and Prevention) at any time of the day or night, telephone number, 770-488-7100 (Breman and Henderson, 2002).
-
Delivery mechanism:
Recent allegations from Ken Alibek, a former deputy director of the Soviet Union's civilian bioweapons program, have heightened concern that smallpox might be used as a bioweapon. Alibek reported that beginning in 1980, the Soviet government embarked on a successful program to produce the smallpox virus in large quantities and adapt it for use in bombs and intercontinental ballistic missiles; the program had an industrial capacity capable of producing many tons of smallpox virus annually. Furthermore, Alibek reports that Russia even now has a research program that seeks to produce more virulent and contagious recombinant strains. Because financial support for laboratories in Russia has sharply declined in recent years, there are increasing concerns that existing expertise and equipment might fall into non-Russian hands (Henderson et al., 1999).
-
Containment:
Medical personnel must be prepared to recognize a vesicular exanthem in possible biowarfare theaters as potentially smallpox, and to initiate appropriate countermeasures. Any confirmed case should be considered an international emergency, with an immediate report made not only to the chain of command but also to public health authorities. Strict quarantine with respiratory isolation should be applied for 17 days to all persons in direct contact with the index case or cases, especially the unvaccinated. Immediate vaccination should also be undertaken for all personnel exposed to either weaponized variola or monkeypox virus or a clinical case of smallpox. Medical personnel should have a history of vaccination and should undergo immediate revaccination to ensure solid immunity (Website 1).
III. Infected Hosts
-
Human:
(Henderson, 1999, Fenner et al., 1988C, Website 1:
-
Taxonomy Information:
-
Species:
-
Human
(Fenner et al., 1988):
-
Infection Process:
-
Infectious Dose:
The infectious dose is unknown but is believed to be only a few virions (Henderson et al., 1999).
It is assumed to be low, 10 to 100 organisms (Franz et al., 1997).
Variola is most effectively spread via the respiratory route with as little as ten plaque-forming units contained within aerosolized saliva able to transmit the infection from person to person (Hassett, 2003).
-
Description:
Smallpox is a viral disease unique to humans. To sustain itself, the virus must pass from person to person in a continuing chain of infection and is spread by inhalation of air droplets or aerosols (Henderson, 1999).
There are three principal routes of viral infection, corresponding to the three principal surfaces of the body: the respiratory tract, the alimentary tract, and the skin. Minor routes of infection include the urinary and genital tracts and the conjunctiva. Although congenital infection occasionally occurred in smallpox, it was of no epidemiological importance (Fenner et al., 1988C).
Variola virus is highly stable and retains its infectivity for long periods outside the host. It is infectious by aerosol, but natural airborne spread to other than close contacts is controversial. Approximately 30% of susceptible contacts became infected during the era of endemic smallpox, and the WHO eradication campaign was predicated on close person-to-person proximity being required for transmission to occur reliably. Nevertheless, variola virus's potential in low relative humidity for airborne dissemination was alarming in two hospital outbreaks (Website 1).
On natural exposure to aerosolized virus, variola travels from the upper or the lower respiratory tract to regional lymph nodes, where it replicates and gives rise to viremia, which is followed soon thereafter by a rash (Website 1).
-
-
Smallpox virus in the cytoplasm of an infected cell (Website 15):
Description: Smallpox virus, growing in the cytoplasm of an infected cell. Thin section of infected chick embryo cell. Mature virions are brick-shaped, but here immature forms are also visible. Smallpox virus was globally eradicated in 1977 by an international vaccination campaign, one of the greatest achievements in history. Magnification approximately x25,000. Micrograph from F. A. Murphy, School of Veterinary Medicine, University of California, Davis.
-
Disease Information:
-
Smallpox
:
-
Pathogenesis Mechanism:
The virus enters the respiratory tract, seeding the mucous membranes and passing rapidly into local lymph nodes. After a brief period of viremia, there is a latent period of 4 to 14 days, during which the virus multiplies in the reticuloendothelial system. Another brief period of viremia precedes the prodromal phase. During the prodromal phase, mucous membranes in the mouth and pharynx are infected. The virus invades the capillary epithelium of the dermal layer in skin, leading to the development of lesions. Oropharyngeal and skin lesions contain abundant viral particles, particularly early in the illness. Virus is also present in urine and conjunctival secretions, with the levels decreasing during convalescence. The spleen, lymph nodes, liver, bone marrow, kidneys, and other viscera may contain large quantities of virus (Breman and Henderson, 2002).
The migration of infected macrophages to lymph nodes after the initial infection elicits the production of cytotoxic T cells and B cells; these responses limit the spread of infection. Neutralizing antibodies appear during the first week of illness but are delayed if the infection is severe; hemagglutination-inhibition antibodies are detectable by day 16 of the infection, and complement-fixation antibodies by day 18. Neutralizing antibodies remain present for many years, whereas levels of hemagglutination-inhibition and complement-fixation antibodies begin to decrease after one year. The correlation between humoral antibodies and protection from smallpox is not entirely clear (Breman and Henderson, 2002).
-
Incubation Period:
The incubation period for smallpox is 7 to 17 days with a mean of 10 to 12 days (Breman and Henderson, 2002).
-
Prognosis:
Smallpox is one of the most communicable of all infectious diseases. Studies have shown that about 30% of people exposed to the virus became infected. Of those who are unvaccinated, 30% may die. Survivors of the disease may experience severe complications including deeply scarred skin, blindness, arthritis, osteomyelitis (bone infection), and infections of the fetus during pregnancy resulting in other severe complications or death of the fetus (Website 2).
-
Diagnosis Overview:
Twelve to 14 days after infection, the patient typically becomes febrile and has severe aching pains and prostration. Some 2 to 3 days later, a papular rash develops over the face and spreads to the extremities. The rash soon becomes vesicular and later, pustular. The patient remains febrile throughout the evolution of the rash and customarily experiences considerable pain as the pustules grow and expand. Gradually, scabs form, which eventually separate, leaving pitted scars. Death usually occurs during the second week (Henderson, 1999).
The disease most commonly confused with smallpox is chickenpox, and during the first 2 to 3 days of rash, it may be all but impossible to distinguish between the two. However, all smallpox lesions develop at the same pace and, on any part of the body, appear identical. Chickenpox lesions are much more superficial and develop in crops. With chickenpox, scabs, vesicles, and pustules may be seen simultaneously on adjacent areas of skin. Moreover, the rash in chickenpox is more dense over the trunk (the reverse of smallpox), and chickenpox lesions are almost never found on the palms or soles (Henderson, 1999).
-
Symptom Information
:
-
Syndrome --
Variola major-ordinary type:
-
Description:
A useful classification proposed by WHO encompasses five types of smallpox. The classification is based on a study of 3544 patients in India (Breman and Henderson, 2002).
-
Observed:
Variola major accounted for nearly 90% of the smallpox cases (Breman and Henderson, 2002).
Symptoms Shown in the Syndrome:
-
Variola major-ordinary type:
-
Description:
The prodromal phase, which lasts for two or three days, is characterized by severe headache, backache, and fever, all beginning abruptly. The temperature often rises to more than 40 degrees C and then subsides over a period of two to three days. Enanthema over the tongue, mouth, and oropharynx precedes the rash by a day. The rash begins as small, reddish macules, which become papules with a diameter of 2 to 3 mm over a period of one or two days; after an additional one or two days, the papules become vesicles with a diameter of 2 to 5 mm. The lesions occur first on the face and extremities but gradually cover the body. Pustules that are 4 to 6 mm in diameter develop about four to seven days after the onset of the rash and remain for five to eight days, followed by umbilication and crusting. There may be a second, less pronounced temperature spike five to eight days after the onset of the rash, especially if the patient has a secondary bacterial infection. The crusts begin separating by the second week of the eruption. Smallpox lesions have a peripheral or centrifugal distribution and are generally all at the same stage of development. Lesions on the palms and soles persist the longest. Death from smallpox is ascribed to toxemia, associated with immune complexes, and to hypotension (Breman and Henderson, 2002).
-
Facial lesions on boy (Website 16):
Description: Copyright: CDC.
-
Observed:
Variola major accounted for nearly 90% of the smallpox cases (Breman and Henderson, 2002).
-
Confluent raised pustular skin lesions:
-
Description:
Confluent raised pustular skin lesions. This subtype encompassed cases in which the pustular skin lesions on the extensor surfaces of the extremities as well as those on the face were confluent. In such cases the temperature, which had fallen on the 4th or 5th day after the onset, rose again 2 days later and remained elevated until scabbing was complete (Fenner et al., 1988).
-
Observed:
Confluent lesions were seen in 22.8% of the total unvaccinated, and 4.6% of the vaccinated smallpox cases. Case fatality rates were 62% among the unvaccinated, and 26.3% among the vaccinated (Fenner et al., 1988).
-
Semiconfluent raised pustular skin lesions:
-
Description:
Semiconfluent raised pustular skin lesions. This was distinguished from confluent ordinary-type smallpox by an arbitrary criterion: the rash was confluent on the face but discrete on the body, including the forearms. A secondary fever often developed during the pustular stage, but the temperature and toxemia were less marked than in the confluent subtype and the temperature subsided as soon as the scabbing had started (Fenner et al., 1988).
-
Observed:
Semiconfluent lesions were seen in 23.9% of the total unvaccinated, and in 7.0% of the vaccinated smallpox cases. Case fatality rates were 37% among the unvaccinated, and 8.4% among the vaccinated (Fenner et al., 1988).
-
Discrete raised pustular skin lesions:
-
Description:
Discrete raised pustular skin lesions. This was the commonest clinical type of variola major. The lesions were fewer in number and discrete (i.e., separated by normal skin) on the face and elsewhere. In some cases, although the lesions were less numerous, the course of the disease was the same as in the other two subtypes; sometimes there was no secondary fever during the pustular stage (Fenner et al., 1988).
-
Observed:
Discrete lesions were seen in 42.1% of the total unvaccinated, and in 58.4% of the vaccinated smallpox cases. Case fatality rates were 9.3% among the unvaccinated, and 0.7% among the vaccinated (Fenner et al., 1988).
-
Syndrome --
Variola major-modified type:
-
Description:
A WHO Scientific group on Smallpox Eradication (1968) defined modified-type smallpox in much the same way as had Ricketts: "In this clinical type, which occurs mostly in vaccinated patients, the modification relates to the character and development of the focal eruption; crusting is complete within 10 days. The pre-eruptive illness may be severe and is not necessarily of short duration, but secondary fever during the evolution of the eruption is usually absent. The skin lesions tend to evolve more quickly, are more superficial, and may not show the uniformity characteristic of the more typical smallpox eruption. The lesions are often few in number, but even when they are numerous they show some pleomorphism and evolve rapidly. A WHO Expert Committee on Smallpox Eradication (1972) qualified this description by relating modified-type smallpox specifically to smallpox in vaccinated persons (Fenner et al., 1988).
-
Observed:
Modified type of variola major was seen in 2.1% of the total unvaccinated, and in 25.3% of the total vaccinated smallpox cases (Fenner et al., 1988).
Symptoms Shown in the Syndrome:
-
Modified type of variola major:
-
Description:
"Modified type" connoted smallpox that was accelerated in its clinical course, compared with the expected evolution of ordinary-type variola major, rather than smallpox whose course was modified by vaccination. By far the commonest reason for an accelerated course in variola major was vaccination some years earlier (Fenner et al., 1988).
-
Observed:
Modified type of variola major was seen in 2.1% of the total unvaccinated, and in 25.3% of the total vaccinated smallpox cases (Fenner et al., 1988). No fatal cases occurred in modified-type smallpox (Fenner et al., 1988).
-
Syndrome --
Variola major-hemorrhagic smallpox:
-
Description:
Considering its comparative rarity (only 200 cases in Rao's series of 6942 hospitalized patients in Madras), a great deal has been written about hemorrhagic-type smallpox. No doubt this preoccupation was due partly to the rarity of the syndrome, its great severity and the difficult problem that is present in differential diagnosis (Fenner et al., 1988).
Hemorrhagic-type smallpox of both subtypes had two unusual epidemiological features: it occurred mostly in adults, and in some extensive series it was as common in vaccinated as in unvaccinated subjects (Fenner et al., 1988).
-
Observed:
Hemorrhagic smallpox was seen in 2.4% of unvaccinated subjects, and in 3.4% of those that had been vaccinated (Fenner et al., 1988).
Symptoms Shown in the Syndrome:
-
Hemorrhages:
-
Description:
In hemorrhagic smallpox there occur widespread hemorrhages in the skin and mucous membranes (Fenner et al., 1988).
-
Observed:
Hemorrhagic smallpox was seen in 2.4% of unvaccinated subjects, and in 3.4% of those that had been vaccinated (Fenner et al., 1988).
-
Early hemorrhagic-type smallpox:
-
Description:
Early hemorrhagic-type smallpox. Early hemorrhagic-type smallpox was characterized by hemorrhages into the skin and/or mucous membranes early in the course of the illness. Subconjunctival hemorrhages were the most common, and bleeding from the gums, epistaxis, haematemesis, haemoptysis, haematuria, as well as vaginal bleeding in women occurred at any time in the course of the illness (Fenner et al., 1988).
-
Observed:
Early hemorrhagic smallpox was seen in 0.7% of unvaccinated subjects, and in 1.4% of those that had been vaccinated. Of these, case fatality rates were 100% in both unvaccinated and vaccinated subjects (Fenner et al., 1988).
-
Late hemorrhagic-type smallpox:
-
Description:
Late hemorrhagic-type smallpox. In late hemorrhagic-type smallpox hemorrhages into the skin and mucous membranes often occurred, and usually also into the bases of the developing skin lesions. Some of these cases could equally well have been considered as cases of flat-type or confluent ordinary-type smallpox, associated with hemorrhages as a complication. However, all classifications contain an arbitrary element (Fenner et al., 1988).
-
Observed:
Late hemorrhagic smallpox was seen in 1.7% of unvaccinated subjects, and in 2.0% of those that had been vaccinated. Of these, case fatality rates were 96.8% in unvaccinated subjects, and 89.8% in those that had been vaccinated (Fenner et al., 1988).
-
Syndrome --
Variola major-variola sine eruptione:
-
Description:
Febrile illness sometimes occurred among vaccinated contacts of cases of smallpox, with a sudden onset, a temperature of about 39 degrees C, headache, and sometimes backache. Within 48 hours or often less the attack had subsided and the temperature was normal. Without laboratory tests it was impossible to determine whether these symptoms had been due to infection with variola virus, but the finding of high complement-rising antibody in such patients, or a rise in antibody titers between the first and second bleeds, indicated that the fever had indeed been due to infection with variola virus; such cases have been called variola sine eruptione (Fenner et al., 1988).
Symptoms Shown in the Syndrome:
-
Fever:
-
Description:
Febrile illness sometimes occurred among vaccinated contacts of cases of smallpox, with a sudden onset, a temperature of about 39 degrees C, headache, and sometimes backache. Within 48 hours or often less the attack had subsided and the temperature was normal (Fenner et al., 1988).
-
Conjunctivitis:
-
Description:
Conjunctivitis. Sometimes conjunctivitis was the only clinical manifestation of smallpox infection (Fenner et al., 1988). In a study directed at the possibility of conjunctival infection in smallpox contacts, Kempe et al. (1969) reported that conjunctivitis but no other illness developed in 21 out of 55 close family contacts of smallpox patients. Variola virus was recovered from the conjunctival exudate of 12 of them (Fenner et al., 1988).
-
Smallpox-handler's lung:
-
Description:
Smallpox-handler's lung. Medical attendants who had been vaccinated and revaccinated but had not often been exposed to smallpox cases sometimes suffered from what appeared to be an allergic pneumonitis. Fever, constitutional symptoms and signs of pneumonia developed between 9 and 18 days after exposure to cases of smallpox, and X-rays showed diffuse mottling of the lungs. None developed a rash, and attempts to recover variola virus from throat washings were unsuccessful (Fenner et al., 1988).
-
Syndrome --
Variola major-flat type:
-
Description:
Flat-type smallpox was so called because the lesions remained more or less flush with the skin at the time when raised vesicles formed in ordinary-type smallpox (Fenner et al., 1988).
-
Observed:
This manifestation of the disease was seldom encountered (6.7% of cases in unvaccinated subjects, and 1.3% in vaccinated subjects), and the majority of cases (72%) occurred in children. It was very rare in successfully vaccinated subjects. The prognosis was always grave and most cases were fatal (Fenner et al., 1988).
Symptoms Shown in the Syndrome:
-
Variola major-flat type:
-
Description:
The enanthem on the tongue and palate was usually extensive and sometimes confluent. Occasionally a severe enanthem occurred on the rectal mucous membrane. The characteristic feature of flat-type smallpox was the nature of the skin lesions. Unlike the regular evolution seen in ordinary-type smallpox, the focal lesions in the skin matured very slowly, and at the papulovesicular stage, about 6 days after the onset of fever, a small depression was visible. By the 7th or 8th day the lesions were flat and appeared to be buried in the skin. Most lesions had hemorrhages into their base, the central flattened portions appeared black or dark purple, and they were surrounded by an erythematous areola. The lesions differed from those of ordinary-type smallpox in that the vesicles contained very little fluid, they were not multilocular, and they did not show umbilication. In contrast to the 'shotty' feel of the lesions in ordinary-type smallpox, they were soft and velvety to the touch. No further evolution of the lesions occurred and frank pustules were rarely seen, although occasionally a few lesions, especially on the dorsum of the feet and hands, became pustular, while elsewhere on the body they remained as flat vesicles. Because of their superficial nature, the skin over the lesions peeled off after sight trauma, sometimes leaving extensive raw areas. Often the skin lesions did not conform to the classical 'centrifugal distribution' (Fenner et al., 1988).
-
Observed:
This manifestation of the disease was seldom encountered (6.7% of cases in unvaccinated subjects, and 1.3% in vaccinated subjects), and the majority of cases (72%) occurred in children. It was very rare in successfully vaccinated subjects. The prognosis was always grave and most cases were fatal (Fenner et al., 1988).
In unvaccinated subjects, 96.5% of the cases were fatal. In vaccinated subjects, 66.7% of the cases were fatal (Fenner et al., 1988).
-
Syndrome --
Variola minor:
-
Description:
In cases of variola minor, which occured mainly in the Americas and parts of Africa, the disease was mild, causing death in less than 1 percent of patients (Breman and Henderson, 2002). Almost all cases of variola minor would have been classified as discrete ordinary or modified-type smallpox, but in an individual case it was impossible to determine whether the disease was variola major or variola minor. The diagnosis depended on the assessment of the clinical severity of the outbreak; if there were no deaths or only one among 50 or so patients the disease was usually variola minor (Breman and Henderson, 2002, Fenner et al., 1988).
-
Observed:
The variety of variola minor differed greatly from variola major in its spectrum of severity and in its case-fatality rates-about 1% compared with about 20% (Fenner et al., 1988).
Symptoms Shown in the Syndrome:
-
Variola minor:
-
Description:
The onset of disease was sudden, with a fever of 40 degree C, severe headache and backache and sometimes vomiting. Marsden recorded the occurrence of pre-eruptive rashes in 48 of the cases he saw during this stage; there were typical erythematous prodromal rashes in 37 cases (Fenner et al., 1988).
The constitutional symptoms of the established disease were usually much less severe than those in cases of variola major with a comparable rash. The toxemia so evident in variola major rarely occurred, and patients with extensive skin rashes were often ambulant. The individual lesions were smaller than those of variola major, so that Marsden was able to count more than 500 lesions on the faces of 295 of his patients without those producing confluence, as would have been expected in variola major. Both MacCallum and Mood and Jong noted that the early vesicles and early pustules were unilocular and were not umbilicated, a clinical finding that was supported by histological examination of biopsy material. The sequence of appearance, the distribution and the nature of the skin lesions were similar to those described earlier for variola major, but their evolution was often more rapid. The eruption became vesicular on the third day after the appearance of the first papules, and within 24 hours had become pustular. Early crusting was established on the sixth or seventh day of rash (Fenner et al., 1988).
Hemorrhagic-type cases did occur in variola minor, but they were extremely rare (Fenner et al., 1988)
-
Fever:
-
Headache:
-
Malaise:
-
Chills:
-
Anorexia:
-
Backache:
-
Pharyngitis:
-
Nausea:
-
Vomiting:
-
Diarrhea:
-
Delirium:
-
Abdominal colic:
-
Convulsions:
-
Treatment Information:
-
Supportive:
There is no treatment approved by the Food and Drug Administration for orthopoxviruses. Penicillinase-resistant antimicrobial agents should be used if smallpox lesions are secondarily infected, if bacterial infection endangers the eyes, or if the eruption is very dense and widespread. Daily eye rinsing is required in severe cases. Patients need adequate hydration and nutrition, because substantial amounts of fluid and protein can be lost by febrile persons with dense, often weeping lesions. Topical idoxuridine (Dendrid, Herplex, or Stoxil) should be considered for the treatment of corneal lesions, although its efficacy is unproved for smallpox (Breman and Henderson, 2002).
-
Cidofovir and its cyclic analogues: EXPERIMENTAL:
Recent studies in animals suggest that cidofovir and its cyclic analogues, given at the time of or immediately after exposure, have promise for the prevention of cowpox, vaccinia, and monkeypox. The drug decreases pulmonary viral levels and pneumonitis in animals with vaccinia or cowpox. In the event of a smallpox outbreak, the drug could be made available under an investigational-new-drug protocol for smallpox or adverse effects of vaccine (Breman and Henderson, 2002).
-
Applicable:
At present, cidofovir (CDV) is the drug of choice for therapy of potential smallpox outbreaks and vaccination complications, and an investigational new drug protocol was approved recently for use in response to an actual smallpox outbreak (Quenelle et al., 2003).
-
Complication:
Cidofovir is toxic to kidney tubules and is not active orally, which necessitates intravenous administration (Quenelle et al., 2003).
-
Prevention:
-
Smallpox Vaccination:
-
Description:
The smallpox vaccine is a live viral vaccine, containing an attenuated vaccinia virus. Intra-dermal administration of smallpox vaccine (vaccinia virus), using a bifurcated needle, can prevent or lessen infection if administered within five days following smallpox exposure. Five vaccine products are available or planned. Stockpiled vaccine product consists of bovine products produced by Wyeth (Dryvax) and Aventis-Pasteur (Wetvax, a liquid preparation, as compared to the lyophilized Dryvax vaccine product. The Dryvax formulation includes polymyxin B, dihydrostreptomycin, chlortetracycline and neomycin as antibacterials. There are no plans to license the Wetvax product due to problems with proper documentation of appropriate storage of the vaccine over the years; it will always be used under an investigational protocol and only in an emergency at a 1:5 dilution. Two new tissue-based vaccine products, ACAM 2000, from the Vero cell line, and ACAM 1000, using the MRC-5 cell line, are being produced by Acambis and will generate an additional 54 million doses. Oravax Inc., a small Massachusetts (United States) biotechnology firm, is poised to enter the market. Biopreparedness plans call for a smallpox vaccine supply sufficient to vaccinate all U.S. citizens, the capacity to deliver millions of doses within 12-24 hours to any state or U.S. territory, and accomplish the distribution of 280 million doses within 5 days; this planning has encouraged other countries to address smallpox preparedness. Presently, only the Dryvax smallpox vaccine product (Wyeth Laboratories) is licensed by the FDA for use in persons age 18 years and older. Several Investigational New Drug (IND) protocols are underway to evaluate other smallpox vaccine products (Mahoney et al., 2003).
Vaccination continues to represent a primary strategy for persons at occupational risk of exposure through culture handling or contact with animals infected with non-highly attenuated vaccinia viruses (e.g. laboratory workers and health care workers) and immediately following exposure (Mahoney et al., 2003).
The modified vaccinia virus Ankara (MVA) vaccine was derived by taking material from a horses pox lesion in Ankara, Turkey and passing it in chick embryo fibroblasts. During the 1970s, MVA was given to over 100,000 persons in Germany and Turkey as a primer to establish basic immunity before later administering the traditional smallpox vaccine during the final phases of a smallpox eradication program. MVA is immunogenic in human cells and appears to have limited capacity for replication. However, its efficacy in an outbreak situation has not been evaluated. The defective vaccinia virus Lister (dVV Lister) genetically alters the Lister strain that is used for the smallpox vaccine in the United Kingdom, Europe, and Israel, so that the virus replicates in few permanent mammalian cell lines. However, dVV Lister has been demonstrated to induce humoral and cellular immunity in mice and both the MVA and dVV Lister were tolerated in immunodeficient mice. Further development and study of these attenuated vaccines in humans is required before they can be introduced on a large scale (Mahoney et al., 2003).
For persons not previously vaccinated, the median effectiveness in preventing disease with vaccination at 0-6 h, 6-24 h, and 1-3 days after exposure was estimated as 93%, 90%, and 80%, respectively, and effectiveness in modifying disease among those who develop illness was estimated as 80%, 80%, and 75%, respectively. Effectiveness was greater for those vaccinated previously. High postexposure vaccination effectiveness for preventing or modifying smallpox is consistent with the limited data available, is biologically plausible, and is similar to that seen for other viral vaccine-preventable diseases (Massoudi et al., 2003).
-
Efficacy:
-
Rate:
Vaccine efficacy is 95% among vaccinees in whom a 1-2 cm loculated and umbilicated pustule (called a Jennerian pustule) is noted 6-8 days after inoculation. The presence of a Jennerian pustule is considered a major reaction and indicates a successful vaccination; lesser reactions require revaccination (Mahoney et al., 2003).
-
Duration:
Primary vaccination results in immunity for 5-10 years, with revaccination yielding immunity for 10-20 years (Mahoney et al., 2003).
We found that more than 90% of volunteers vaccinated 25-75 years ago still maintain substantial humoral or cellular immunity (or both) against vaccinia, the virus used to vaccinate against smallpox. Antiviral antibody responses remained stable between 1-75 years after vaccination, whereas antiviral T-cell responses declined slowly, with a half-life of 8-15 years. If these levels of immunity are considered to be at least partially protective, then the morbidity and mortality associated with an intentional smallpox outbreak would be substantially reduced because of pre-existing immunity in a large number of previously vaccinated individuals (Hammarlund et al., 2003).
-
Contraindicator:
Some people are at greater risk for serious side effects from the smallpox vaccine. Individuals who have any of the following conditions, or live with someone who does, should NOT get the smallpox vaccine unless they have been exposed to the smallpox virus: 1. Eczema or atopic dermatitis. (This is true even if the condition is not currently active, mild or experienced as a child.) 2. Skin conditions such as burns, chickenpox, shingles, impetigo, herpes, severe acne, or psoriasis. (People with any of these conditions should not get the vaccine until they have completely healed.) 3. Weakened immune system. (Cancer treatment, an organ transplant, HIV, Primary Immune Deficiency disorders, some severe autoimmune disorders and medications to treat autoimmune disorders and other illnesses can weaken the immune system.) 4. Pregnancy or plans to become pregnant within one month of vaccination. In addition, individuals should not get the smallpox vaccine if they: 5. Are allergic to the vaccine or any of its ingredients (polymyxin B, streptomycin, chlortetracycline, neomycin). 6. Are younger than 12 months of age. However, the Advisory Committee on Immunization Practices (ACIP) advises against non-emergency use of smallpox vaccine in children younger than 18 years of age. In addition, the vaccine manufacturers package insert states that the vaccine is not recommended for use in geriatric populations in non-emergency situations. The term geriatric generally applies to people age 65 and above. 7. Have a moderate or severe short-term illness. (These people should wait until they are completely recovered to get the vaccine.) 8. Are currently breastfeeding. 9. Are using steroid drops in their eyes. (These people should wait until they are no longer using the medication to get the vaccine). 10. Have been diagnosed by a doctor as having a heart condition with or without symptoms, including conditions such as previous myocardial infarction (heart attack), angina (chest pain caused by lack of blood flow to the heart), congestive heart failure, cardiomyopathy (heart muscle becomes inflamed and doesn't work as well as it should), stroke or transient ischemic attack (a "mini-stroke" that produces stroke-like symptoms but not lasting damage), chest pain or shortness of breath with activity (such as walking up stairs), or other heart conditions being treated by a doctor. (While this may be a temporary exclusion, these people should not get the vaccine at this time.) 11. Have 3 or more of the following risk factors: high blood pressure diagnosed by a doctor; high blood cholesterol diagnosed by a doctor; diabetes or high blood sugar diagnosed by a doctor; a first degree relative (for example, mother, father, brother, sister) who had a heart condition before the age of 50; and, you smoke cigarettes now. (While this may be a temporary exclusion, these people should not get the vaccine at this time) (Website 14).
-
Complication:
Risk of complications from the smallpox vaccine is higher than for any other routinely used vaccine product. Most of our knowledge about adverse reactions to the smallpox vaccine (vaccinia) is based upon studies completed during the 1950s and 1960s, a period when the general population was vaccinated as part of standard care. Studies from the 1960s document a death rate of 1 per million primary smallpox vaccinations; rates of adverse reactions are highest among children aged less than 5 years. Minor side effects include fever in 70% of children lasting up to 14 days. Complication rates were higher among primary vaccinees (125 per 100,000) than in those receiving revaccination (10.8 per 1,000,000) (Mahoney et al., 2003).
Serious adverse events, based on past experience, included death (1/million primary vaccinees) and post-vaccine encephalitis (range 1 to 10 cases /million). These generally occur among infants and the elderly. Other commonly observed adverse reactions included a robust primary reaction (incidence of 4-18%); generalized vaccinia (240 cases/1 million primary vaccinations) with vesicles/pustules distant from vaccine site, and mild systemic illness. Inadvertent inoculation to other places on the body (529 cases/million), eczema vaccinatum (1/25,000) generally occurring among persons with a history of eczema; progressive vaccinia (1/600,000) seen among persons with impaired T-cell function with necrosis at the vaccine site and with severe and potentially fatal systemic illness. In addition, transmission of vaccinia from vaccinees to susceptible contacts occurred at a rate of 27 infections/million vaccinations (Mahoney et al., 2003).
Beginning in early 2003, a pre-event smallpox vaccination program was initiated in the U.S. As of May 2003, 36,217 civilians have been vaccinated, in addition to more than 240,000 military vaccinees. Recent experiences have revealed that one-third of 680 persons who received smallpox vaccine reported missing school, modifying recreational activities or disturbed sleep following vaccinia vaccination; 1 in 4 recent vaccinees noted mild systemic reactions (B. Schwartz, CDC, June 2002). Local skin irritation, satellite lesions, headache, myalgia, lymphadenopathy, nausea, chills and fever for 1-2 weeks post-innoculum is common. A robust primary reaction is likely to result in either ambulatory visits or time lost from work or school (Mahoney et al., 2003).
Six cases of myopericarditis have been confirmed with an additional 18 suspect cases reported among vaccinees. These events have resulted in three deaths. Following extensive review, these data were judged to be sufficient to establish causality between the development of myocarditis/pericarditis and administration of the smallpox vaccine. However, no causal relationship was found between cardiac ischemic events and smallpox vaccination. It is worthwhile to note that in 1968, only one case of transient pericarditis was reported (less than 1/million vaccinees). Aside from these cardiac events, no other serious complications have been reported in the current immunization program at the time of this writing (Mahoney et al., 2003).
From January though July 2003, more than 38,000 US civilians and more than 450,000 US military personnel received the smallpox vaccine. As of July 25, 2003, the CDC reported three cases of generalized vaccinia, 18 cases of autoinoculation, 21 cases of myopericarditis, three cases of ocular vaccinia, and one case of postvaccinial encephalitis (Maurer et al., 2003).
The military experience through June 25, 2003 is notable for 36 cases of generalized vaccinia, one case of erythema multiforme, 48 cases of autoinoculation, 37 cases of myopericarditis, and one case of postvaccinial encephalitis (Maurer et al., 2003).
All cases of generalized vaccinia and myopericarditis have occurred in primary vaccinees. Overall, there have been fewer adverse reactions during this new vaccination period than what was predicted using historical data. Although there have been no deaths directly attributable to the smallpox vaccine, the CDC has reported five ischemic cardiac events following smallpox vaccination, with two deaths, and the US military has reported one death from myocardial infaction five days after vaccination. These events, along with the number of myopericarditis cases, have led to revised screening recommendations for patients with known cardiac disease, vessel-related condition, or other risk factors (Maurer et al., 2003).
-
Patient Isolation (Breman and Henderson, 2002):
-
Description:
The only weapons against the disease are vaccination and patient isolation (Henderson, 1999).
A suspect case of smallpox should be managed in a negative-pressure room, if possible, and the patient should be vaccinated, particularly if the illness is in an early stage. Strict respiratory and contact isolation is imperative. When there are many patients, an isolation hospital or other facility should be designated (Breman and Henderson, 2002).
-
Model System:
No model system information is currently available here.
IV. Labwork Information
A. Biosafety Information:
-
Biosafety information for
:
Variola virus
(Henderson et al., 1999):
-
Biosafety Level: Laboratory examination requires high-containment (BL-4) facilities and should be undertaken only in designated laboratories with the appropriate training and equipment.
-
Precautions:
-
Laboratory confirmation of the diagnosis in a smallpox outbreak is important. Specimens should be collected by someone who has recently been vaccinated (or is vaccinated that day) and who wears gloves and a mask. To obtain vesicular or pustular fluid, it is often necessary to open lesions with the blunt edge of a scalpel. The fluid can then be harvested on a cotton swab. Scabs can be picked off with forceps. Specimens should be deposited in a vacutainer tube that should be sealed with adhesive tape at the juncture of stopper and tube. This tube, in turn, should be enclosed in a second durable, watertight container. State or local health department laboratories should immediately be contacted regarding the shipping of specimens (Henderson et al., 1999).
B. Culturing Information:
-
Variola virus Culturing Methods
:
-
Description:
Most orthopox viruses can be grown in one or another kind of cultured cell and assayed by plaque counts in suitable susceptible cells (Fenner et al., 1988B).
Species with a restricted host range, such as variola virus, replicate in a narrower range of cells and often produce hyperplastic foci. However, on serial passage, adaptation occurs readily and may involve change to a more lytic plaque. Monolayers infected with viruses that produce hyperplastic foci usually yield much less virus than those infected with viruses that produce lytic plaques, since most cells in the monolayer remain uninfected. Differential growth capacity in particular cell lines (e.g., the rabbit cell line RK 13 and pig embryo kidney cells) may be useful in distinguishing between variola and monkeypox viruses when these viruses are first inoculated into such cells; however, adaptation occurs readily (Fenner et al., 1988B).
-
Medium:
-
Most human and non-human primate cells, and some cells derived from other species (rabbit kidney and pig embryo kidney cells) are susceptible to infection with variola virus (Fenner et al., 1988B).
Growth in pig embryo kidney cells was sometimes used to differentiate between variola and monkeypox viruses (Fenner et al., 1988B).
-
Note:
Out of 186 specimens that were tested by all four methods, 182 were positive by electron microscopy, 135 by tissue culture inoculation and 117 by chorioallantoic membrane inoculation. Gel precipitation was the least sensitive technique (Fenner et al., 1988B).
C. Diagnostic Tests
:
-
Organism Detection Tests:
-
Variola virus Particles Detection:
-
Time to Perform:
minutes-to-1-hour
-
Description:
Under light microscopy, aggregations of variola virus particles, called Guarnieri bodies, correspond to B-type poxvirus inclusions. These cytoplasmic inclusions are hematoxylinophilic, stain reddish purple with Giemsa stain, and contain Feulgen-positive material (Website 1).
The appearance of characteristic virions on electron microscopy or Guarnieri bodies under light microscopy is useful but does not discriminate variola from vaccinia, monkeypox, or cowpox (Franz et al., 1997).
-
Variola virus Electron Microscopy:
-
Time to Perform:
1-hour-to-1-day
-
Description:
Widespread use of electron microscopy as a diagnostic method was not feasible until the negative staining technique was introduced (Fenner et al., 1988B).
Others have shown the value of this method for recognizing poxvirus or herpes virus particles in vesicle fluid and scabs taken directly from patients (Fenner et al., 1988B).
Electron microscopy had the advantage of being much the most rapid method of making a presumptive diagnosis, which was a very important requirement, especially in nonendemic countries. In scabs or material that had been some time in transit, it was also the most sensitive, although fields might have to be searched for as long as 30 minutes before a specimen was declared negative (Fenner et al., 1988B).
The appearance of characteristic virions on electron microscopy or Guarnieri bodies under light microscopy is useful but does not discriminate variola from vaccinia, monkeypox, or cowpox (Franz et al., 1997).
-
False Positive:
Out of 186 specimens that were tested by all four methods, 182 were positive by electron microscopy, 135 by tissue culture inoculation and 117 by chorioallantoic membrane inoculation. Gel precipitation was the least sensitive technique (Fenner et al., 1988B).
-
Gel diffusion or gel precipitation:
-
Description:
The gel diffusion test, in which vesicular fluid from a pox lesion was incubated with vaccinia hyperimmune serum, constitutes a rapid and inexpensive method when microscopy is not available (Website 1).
-
False Positive:
Out of 186 specimens that were tested by all four methods, 182 were positive by electron microscopy, 135 by tissue culture inoculation and 117 by chorioallantoic membrane inoculation. Gel precipitation was the least sensitive technique (Fenner et al., 1988B).
-
False Negative:
The gel precipitation was the least sensitive technique and was often negative in lesion material that had been exposed to ambient temperatures for several days (Fenner et al., 1988B).
-
Inoculation of the chorioallantoic membrane:
-
Description:
Although cell culture was sometimes more sensitive, inoculation on the chorioallantoic membrane was generally a more useful test with field material, since positive results could be obtained even with scabs that were contaminated with bacteria, which typically destroyed cell cultures. Also, if the content of viable virus was low it often took several days, and perhaps serial passage, before characteristic lesions occurred in cultured cells, whereas a result could always be obtained within 3 days by chorioallantoic membrane inoculation (Fenner et al., 1988B). Inoculation on the chorioallantoic membrane had the great advantage of allowing differentiation between the 4 orthopoxviruses that can infect man (variola, monkeypox, cowpox, and vaccinia viruses). It was also the most sensitive with fresh specimens of vesicular fluid, since one infectious particle was potentially capable of producing a pox (Fenner et al., 1988B).
-
False Positive:
Out of 186 specimens that were tested by all four methods, 182 were positive by electron microscopy, 135 by tissue culture inoculation and 117 by chorioallantoic membrane inoculation. Gel precipitation was the least sensitive technique (Fenner et al., 1988B).
-
False Negative:
In 1979 Nakano found that the susceptibility of the chorioallantoic membrane, although usually quite satisfactory, was sometimes unacceptably low, as judged by control inoculation in cultured cells. For this reason he found it useful to make inoculations on cultured cells, especially with critical specimens in which recovery of the responsible virus was very desirable (Fenner et al., 1988B).
-
Immunoassay Tests:
No immuno-assay tests available here.
-
Nucleic Acid Detection Tests:
:
-
Ibrahim's PCR Detection:
-
Description:
We developed a highly sensitive and specific assay for the rapid detection of smallpox virus DNA on both the Smart Cycler and LightCycler platforms. The assay is based on TaqMan chemistry with the orthopoxvirus hemagglutinin gene used as the target sequence. With genomic DNA purified from variola virus Bangladesh 1975, the limit of detection was estimated to be approximately 25 copies on both machines. The assay was evaluated in a blinded study with 322 coded samples that included genomic DNA from 48 different isolates of variola virus; 25 different strains and isolates of camelpox, cowpox, ectromelia, gerbilpox, herpes, monkeypox, myxoma, rabbitpox, raccoonpox, skunkpox, vaccinia, and varicella-zoster viruses; and two rickettsial species at concentrations mostly ranging from 100 fg/microl. to 1 ng/microl. Contained within those 322 samples were variola virus DNA, obtained from purified viral preparations, at concentrations of 1 fg/ microl to 1 ng/ microl. On the Smart Cycler platform, 2 samples with false-positive results were detected among the 116 samples not containing variola virus tested; i.e., the overall specificity of the assay was 98.3%. On the LightCycler platform, five samples with false-positive results were detected (overall specificity, 95.7%). Of the 206 samples that contained variola virus DNA ranging in concentrations from 100 fg/ microl to 1 ng/ microl, 8 samples were considered negative on the Smart Cycler platform and 1 sample was considered negative on the LightCycler platform. Thus, the clinical sensitivities were 96.1% for the Smart Cycler instrument and 99.5% for the LightCycler instrument. The vast majority of these samples were derived from virus-infected cell cultures and variola virus-infected tissues; thus, the DNA material contained both viral DNA and cellular DNA. Of the 43 samples that contained purified variola virus DNA ranging in concentration from 1 fg/ microl to 1 ng/ microl, the assay correctly detected the virus in all 43 samples on both the Smart Cycler and the LightCycler platforms. The assay may be useful for the early detection of smallpox virus infections should such infections occur as a result of a deliberate or an accidental recurrence (Ibrahim et al., 2003).
-
Primers:
-
OPXJ7R3U, OPXJ7R3L and probe VARJ7R3P
-
False Positive:
On the Smart Cycler platform, 2 samples with false-positive results were detected among the 116 samples not containing variola virus tested; i.e., the overall specificity of the assay was 98.3%. On the LightCycler platform, five samples with false-positive results were detected (overall specificity, 95.7%) (Ibrahim et al., 2003).
-
False Negative:
Of the 206 samples that contained variola virus DNA ranging in concentrations from 100 fg/ microl to 1 ng/ microl, 8 samples were considered negative on the Smart Cycler platform and 1 sample was considered negative on the LightCycler platform (Ibrahim et al., 2003).
-
Ropp's PCR Detection:
-
Description:
Rapid identification and differentiation of orthopoxviruses by PCR were achieved with primers based on genome sequences encoding the hemagglutinin (HA) protein, an infected-cell membrane antigen that distinguishes orthopoxviruses from other poxvirus genera. The initial identification step used a primer pair (NACP1 and NACP2) of consensus sequences for amplifying an HA DNA fragment from the three known North American orthopoxviruses (raccoonpox, skunkpox, and volepox viruses), and a second pair EACP1 and EACP2) for amplifying virtually the entire HA open reading frame of the Eurasian-African orthopoxviruses (variola, vaccinia, cowpox, monkeypox, camelpox, ectromelia, and gerbilpox viruses). RsaI digest electropherograms of the amplified DNAs of the former subgroup provided species differentiation, and TaqI digests differentiated the Eurasian-African orthopoxviruses, including vaccinia virus from the vaccinia virus subspecies buffalopox virus. Endonuclease HhaI digest patterns distinguished smallpox variola major viruses from alastrim variola minor viruses. For the Eurasian-African orthopoxviruses, a confirmatory step that used a set of higher-sequence-homology primers was developed to provide sensitivity to discern individual virus HA DNAs from cross-contaminated orthopoxvirus DNA samples; TaqI and HhaI digestions of the individual amplified HA DNAs confirmed virus identity. Finally, a set of primers and modified PCR conditions were developed on the basis of base sequence differences within the HA genes of the 10 species, which enabled production of a single DNA fragment of a particular size that indicated the specific species (Ropp et al., 1995).
-
Primers:
-
NACP
-
Forward:
ACGATGTCGTATACTTTGAT
-
Reverse:
GAAACAACTCCAAATATCTC
-
Product
-
VAR
-
Forward:
TAAATCATTGACTGCTAA
-
Reverse:
GTAGATGGTTCATTATCATTGTG
-
Product
-
Espy's PCR Detection (Espy et al., 2002):
-
Description:
A 300-bp plasmid fragment of the hemagglutinin gene was used as target DNA to develop a rapid real-time LightCycler (Roche Applied Science, Indianapolis, Ind.) PCR assay for laboratory detection of smallpox virus. PCR primers and probes were designed specifically for detection of smallpox virus DNA, but all viruses of the genus Orthopoxvirus tested could be detected by use of the hemagglutinin gene target sequence. Base pair mismatches in the 204-bp amplicon allowed discrimination of cowpox virus (melting temperature [Tm], 56.40 C), monkeypox virus (Tm, 56.24 C), and vaccinia virus (Tm, 56.72 C), including the Dryvax vaccine strain, from smallpox virus (Tm, 62.45 C) by melting curve analysis. The analytical sensitivity was 5 to 10 copies of target DNA per sample. The assay was specific for members of the genus Orthopoxvirus; the DNAs of herpes simplex virus and varicella-zoster virus were not detected by the smallpox virus LightCycler PCR (Espy et al., 2002).
-
Primers:
-
Pair of primers
-
Forward:
CTA ATA TCA TTA GTA TAC GCT ACA C
-
Reverse:
GAG TCG TAA GAT ATT TTA TCC
-
Product
-
Restriction fragment length polymorphism (RFLP) assay (Loparev et al., 2001):
-
Description:
A restriction fragment length polymorphism (RFLP) assay was developed to identify and differentiate Old World, African-Eurasian orthopoxviruses (OPV): variola, vaccinia, cowpox, monkeypox, camelpox, ectromelia, and taterapox viruses. The test uses amplicons produced from virus genome DNA by PCR with a consensus primer pair designed from sequences determined for the cytokine response modifier B (crmB) gene of 43 different OPV strains of known taxonomic origin. The primer pair amplified a single specific product from each of the 115 OPV samples tested. Size-specific amplicons identified and differentiated ectromelia and vaccinia virus strains, which contain a truncated crmB gene, and enabled their differentiation from other OPV species. Restriction digests of amplified products allowed the identification and differentiation of variola, monkeypox, camelpox, vaccinia, and cowpox virus species and strains (Loparev et al., 2001).
-
Microarray method to detect Orthopox viruses:
-
Time to Perform:
1-hour-to-1-day
-
Description:
We have developed a new microarray-based method that detects simultaneously and discriminates four orthopoxvirus (OPV) species pathogenic for humans (variola, monkeypox, cowpox, and vaccinia viruses) and distinguishes them from chickenpox virus (varicella-zoster virus or VZV). The OPV gene C23L/B29R, encoding the CC-chemokine binding protein, was sequenced for 41 strains of seven species of orthopox viruses obtained from different geographical regions. Those C23L/B29R sequences and the ORF 62 sequences from 13 strains of VZV (selected from GenBank) were used to design oligonucleotide probes that were immobilized on an aldehyde-coated glass surface (a total of 57 probes). The microchip contained several unique 13-21 bases long oligonucleotide probes specific to each virus species to ensure redundancy and robustness of the assay. A region approximately 1100 bases long was amplified from samples of viral DNA and fluorescently labeled with Cy5-modified dNTPs, and single-stranded DNA was prepared by strand separation. Hybridization was carried out under plastic coverslips, resulting in a fluorescent pattern that was quantified using a confocal laser scanner. 49 known and blinded samples of OPV DNA, representing different OPV species, and two VZV strains were tested. The oligonucleotide microarray hybridization technique identified reliably and correctly all samples. This new procedure takes only 3 h, and it can be used for parallel testing of multiple samples (Laassri et al., 2003).
-
Other Types of Diagnostic Tests:
No other tests available here.
V. References
A. Journal References:
Breman and Henderson, 2002:
Breman Joel G. ,
Henderson D.A. Diagnosis and Management of smallpox.
The New England Journal of Medicine.
2002 ;
346 ( 17 ):
1300 -
1308 .
[PubMed:
11923491].
Espy et al., 2002:
Espy M.J. ,
Cockerill III F.R. ,
Meyer R.F. , Bowen MD, Poland GA, Hadfield TL, Smith TF. Detection of smallpox virus DNA by LightCycler PCR.
J Clin Microbiol .
2002 ;
40 ( 6 ):
1985 -
1988 .
[PubMed:
12037052].
Franz et al., 1997:
Franz David R. ,
Jahrling Peter B. ,
Friedlander Arthur M. , McClain DJ, Hoover DL, Bryne WR, Pavlin JA, Christopher GW, Eitzen EM Jr. Clinical recognition and management of patients exposed to biological warfare agents.
JAMA .
1997 ;
278 ( 5 ):
399 -
411 .
[PubMed:
9244332].
Goldstein et al., 1975:
Goldstein J.A. ,
Neff J.M. ,
Lane J.M. , Koplan. Smallpox vaccination reactions, prophylaxis, and therapy of complications.
Pediatrics .
1975 ;
55 ( 3 ):
342 -
347 .
[PubMed:
238178].
Hammarlund et al., 2003:
Hammarlund E,
Lewis MW,
Hansen SG, Strelow LI, Nelson JA, Sexton GJ, Hanifin JM, Slifka MK. Duration of antiviral immunity after smallpox vaccination.
Nat Med..
2003;
9(9):
1131 -
1137.
[PubMed:
12925846].
Hassett, 2003:
Hassett DE Smallpox infections during pregnancy, lessons on pathogenesis from nonpregnant animal models of infection.
J Reprod Immunol.
2003;
60(1):
13 -
24.
[PubMed:
14568674].
Henderson, 1999:
Henderson D.A. Smallpox: clinical and epidemiologic features.
Emerg Infect Dis .
1999 ;
5 ( 4 ):
537 -
539 .
[PubMed:
10458961].
Henderson et al., 1999:
Henderson D.A. ,
Inglesby T.V. ,
Bartlett J.G. , Ascher MS, Eitzen E, Jahrling PB, Hauer J, Layton M, McDade J, Osterholm MT, O'Toole T, Parker G, Perl T, Russell PK, Tonat K. Smallpox as a biological weapon: medical and public health management. Working Group on Civilian Biodefense.
JAMA .
1999 ;
281 ( 22 ):
2127 -
2137 .
[PubMed:
10367824].
Ibrahim et al., 2003:
Ibrahim MS,
Kulesh DA,
Saleh SS, Damon IK, Esposito JJ, Schmaljohn AL, Jahrling PB. Real-time PCR assay to detect smallpox virus.
J Clin Microbiol..
2003;
41(8):
3835 -
3839.
[PubMed:
12904397].
Klietmann and Ruoff, 2001:
Klietmann W.F. ,
Ruoff K.L. Bioterrorism: implications for the clinical microbiologist.
Clin Microbiol Rev.
2001 ;
14 ( 2 ):
364 -
381 .
[PubMed:
11292643].
Laassri et al., 2003:
Laassri M,
Chizhikov V,
Mikheev M, Shchelkunov S, Chumakov K. Detection and discrimination of orthopoxviruses using microarrays of immobilized oligonucleotides.
J Virol Methods.
2003;
112(1-2):
67 -
78.
[PubMed:
12951214].
Loparev et al., 2001:
Loparev V.N. ,
Massung R.F. ,
Esposito J.J. , Meyer H. Detection and differentiation of old world orthopoxviruses: restriction fragment length polymorphism of the crmB gene region.
J Clin Microbiol.
2001 ;
39 ( 1 ):
94 -
100 .
[PubMed:
11136755].
Mahoney et al., 2003:
Mahoney MC,
Symons AB,
Kimmel SR. Smallpox: clinical highlights and considerations for vaccination.
J Postgrad Med..
2003;
49(2):
141 -
147.
[PubMed:
12867690].
Massoudi et al., 2003:
Massoudi MS,
Barker L,
Schwartz B. Effectiveness of postexposure vaccination for the prevention of smallpox: results of a delphi analysis.
J Infect Dis.
2003;
188(7):
973 -
976.
[PubMed:
14513416].
Massung et al., 1994:
Massung R.F. ,
Liu L.I. ,
Knight J.C. , Knight JC, Yuran TE, Kerlavage AR, Parsons JM, Venter JC, Esposito JJ. Analysis of the complete genome of smallpox variola major virus strain Bangladesh-1975.
Virology .
1994 ;
201 ( 2 ):
215 -
240 .
[PubMed:
8184534].
Maurer et al., 2003:
Maurer DM,
Harrington B,
Lane LM. Smallpox vaccine: contraindications, administration, and adverse reactions.
Am Fam Physician.
2003;
68(5):
889 -
896.
[PubMed:
13678138].
MMWR, 2002:
25th Anniversary of the last case of naturally acquired smallpox.
MMWR Morb Mortal Wkly Rep .
2002 ;
51 ( 42 ):
952 -
952 .
[PubMed:
12442741].
Quenelle et al., 2003:
Quenelle DC,
Collins DJ,
Kern ER Efficacy of multiple- or single-dose cidofovir against vaccinia and cowpox virus infections in mice.
Antimicrob Agents Chemother..
2003;
47(10):
3275 -
3280.
[PubMed:
14506041].
Ropp et al., 1995:
Ropp S.L. ,
Jin Q. ,
Knight J.C. , Massung RF, Esposito JJ. PCR strategy for identification and differentiation of smallpox and other orthopoxviruses.
J Clin Microbiol.
1995 ;
33 ( 8 ):
2069 -
2076 .
[PubMed:
7559950].
Shchelkunov et al., 1993:
Shchelkunov Sergei N. ,
Blinov Vladimir M. ,
Sandakhchiev Lev S. Genes of variola and vaccinia viruses necessary to overcome the host protective mechanisms.
FEBS Lett .
1993 ;
319 ( 1-2 ):
80 -
83 .
[PubMed:
8384129].
Shchelkunov et al., 2000:
Shchelkunov S.N. ,
Totmenin A.V. ,
Loparev V.N. , Safronov PF, Gutorov VV, Chizhikov VE, Knight JC, Parsons JM, Massung RF, Esposito JJ.
Alastrim smallpox variola minor virus genome DNA sequences.
Virology.
2000 ;
266 ( 2 ):
361 -
386 .
[PubMed:
10639322].
B. Book References:
Fenner et al., 1988:
Fenner F. ,
Henderson D.A. ,
Arita I. ,
Jezek Z. ,
Ladnyi I.D. Chapter 1: The clinical features of smallpox.
1 -
68 .
In: Smallpox and its eradication 1988 .
World Health Organization (WHO) ,
.
Fenner et al., 1988B:
Fenner F. ,
Henderson D.A. ,
Arita I. ,
Jezek Z. ,
Ladnyi I.D. Chapter 2: Variola virus and other orthopoxviruses>.
69 -
119 .
In: Smallpox and its eradication 1988 .
World Health Organization (WHO) ,
.
Fenner et al., 1988C:
Fenner F. ,
Henderson D.A. ,
Arita I. ,
Jezek Z. ,
Ladnyi I.D. Chapter 4: The epidemiology of smallpox .
169 -
208 .
In: Smallpox and its eradication 1988 .
World Health Organization (WHO) ,
.
C. Website References:
Website 1:
Smallpox [
http://www.vnh.org/MedAspChemBioWar/chapters/chapter_27.htm
].
Website 2:
Smallpox [
http://www.emedicine.com/aaem/topic550.htm
].
Website 3:
Homo sapiens [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Tree&id=9606&lvl=3&keep=1&srchmode=1&unlock
].
Website 4:
Variola virus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=10255&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 5:
Variola major virus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=12870&lvl=3&keep=1&srchmode=1&unlock
].
Website 6:
Variola minor virus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=53258&lvl=3&keep=1&srchmode=1&unlock
].
Website 7:
Variola virus, complete genome [
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=9627521&dopt=GenBank
].
Website 8:
Variola major virus (strain Bangladesh-1975) complete genome [
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=623595&dopt=GenBank
].
Website 9:
Variola minor virus complete genome [
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=1150658&dopt=GenBank
].
Website 10:
variola minor virus complete genome [
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=5830555&dopt=GenBank
].
Website 11:
Variola virus DNA complete genome [
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=456758&dopt=GenBank
].
Website 12:
CDC: Public Health Emergency Preparedness and Response [
http://www.bt.cdc.gov/emcontact/index.asp
].
Website 13:
Smallpox Fact Sheet. Smallpox Overview [
http://www.bt.cdc.gov/agent/smallpox/overview/disease-facts.asp
].
Website 14:
SMALLPOX FACT SHEET People Who Should NOT Get the Smallpox Vaccine (Unless they are exposed to smallpox) [
http://www.bt.cdc.gov/agent/smallpox/vaccination/contraindications-public.asp
].
Website 15:
UCDavis School Of Veterinary Medicine Virus Images [
http://www.vetmed.ucdavis.edu/viruses/download.html
].
Website 16:
Smallpox Disease Images at CDC [
http://www.bt.cdc.gov/agent/smallpox/smallpoximages.asp
].
D. Thesis References:
No thesis or dissertation references used.
VI. Curation Information
-
Curators:
Rebecca Wattam
-
Date: 05/15/2004
-
Version: 1.0
-
Contact information:
- Email: wattam@vbi.vt.edu or pathinfo@vbi.vt.edu